Incidental Mutation 'R2081:Mast2'
ID229466
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Namemicrotubule associated serine/threonine kinase 2
SynonymsMAST205, Mtssk
MMRRC Submission 040086-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2081 (G1)
Quality Score166
Status Not validated
Chromosome4
Chromosomal Location116306762-116464183 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 116330474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486] [ENSMUST00000123072] [ENSMUST00000144281]
Predicted Effect probably null
Transcript: ENSMUST00000003908
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106484
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106485
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106486
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123072
SMART Domains Protein: ENSMUSP00000118340
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
Pfam:DUF1908 58 203 2.9e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134460
Predicted Effect probably null
Transcript: ENSMUST00000144281
SMART Domains Protein: ENSMUSP00000122625
Gene: ENSMUSG00000003810

DomainStartEndE-ValueType
Pfam:DUF1908 57 144 2.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl6 A G 11: 54,320,259 T28A possibly damaging Het
Actl11 G A 9: 107,930,197 G573D probably benign Het
Adam39 T A 8: 40,826,842 *757K probably null Het
Agpat4 T C 17: 12,151,884 I38T possibly damaging Het
Akap2 G A 4: 57,855,927 E419K possibly damaging Het
Ap3d1 A C 10: 80,732,936 I36S probably damaging Het
Arhgap45 T C 10: 80,027,674 F784L probably damaging Het
Atp10b T A 11: 43,202,128 I430N probably damaging Het
Atrip T A 9: 109,072,739 probably null Het
C2cd4b G T 9: 67,760,577 R285L probably damaging Het
Camta1 T C 4: 151,144,242 E711G probably benign Het
Clcn6 T C 4: 148,011,068 Y685C probably damaging Het
Col18a1 T A 10: 77,054,185 D1447V probably damaging Het
Crispld1 T A 1: 17,762,179 V463D probably damaging Het
Crybg2 T G 4: 134,088,820 F1612V possibly damaging Het
Dclk1 T C 3: 55,521,925 probably null Het
Ddx46 G T 13: 55,674,016 V834L probably benign Het
Dnah10 A G 5: 124,774,981 D1734G possibly damaging Het
Dpep1 T C 8: 123,199,378 V152A probably damaging Het
Ect2l T C 10: 18,165,527 E301G probably damaging Het
Elf3 C T 1: 135,257,076 C124Y probably benign Het
Eno2 A G 6: 124,763,125 V316A probably damaging Het
Erap1 A G 13: 74,675,307 E820G possibly damaging Het
Evpl A T 11: 116,234,266 H123Q probably damaging Het
Fat2 T A 11: 55,309,677 Y857F possibly damaging Het
Fbrsl1 T A 5: 110,371,625 probably null Het
Fbxw7 A G 3: 84,974,513 D432G probably damaging Het
Flt1 A T 5: 147,639,422 L592Q probably damaging Het
Gm14496 T A 2: 182,000,479 C648S probably damaging Het
Gm5150 A T 3: 15,990,945 S39T probably benign Het
Gm5426 T C 10: 96,136,739 I46T possibly damaging Het
Gse1 C A 8: 120,566,480 P177Q probably damaging Het
Heatr4 G A 12: 83,980,322 R54W probably damaging Het
Hpgd C A 8: 56,307,642 Q125K probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Mfsd11 A G 11: 116,861,555 T177A possibly damaging Het
Mlx T C 11: 101,087,431 S36P probably benign Het
Mlxipl T A 5: 135,113,638 V102D probably damaging Het
Mms22l T C 4: 24,536,150 Y540H probably damaging Het
Msc T C 1: 14,755,717 D11G probably benign Het
Muc4 C G 16: 32,752,220 S699R probably benign Het
Nckap1l T C 15: 103,497,454 S1106P probably damaging Het
Obscn T C 11: 59,034,182 E5703G possibly damaging Het
Olfr705 A G 7: 106,714,198 M161T probably benign Het
Pabpn1 A G 14: 54,895,658 K38E probably damaging Het
Padi3 A T 4: 140,798,979 L141Q probably damaging Het
Pde3b A G 7: 114,523,422 N742D probably benign Het
Pex1 T A 5: 3,624,132 probably null Het
Pkd2 T C 5: 104,460,211 V192A probably benign Het
Ppp6r2 T A 15: 89,282,129 M750K probably benign Het
Prdm15 A T 16: 97,803,780 Y783* probably null Het
Prox2 T A 12: 85,095,008 Q140H probably damaging Het
Psg27 A T 7: 18,556,958 I440K probably damaging Het
Pzp A G 6: 128,519,420 M283T probably benign Het
Sec23a G A 12: 58,998,281 Q192* probably null Het
Sh2b1 A G 7: 126,472,690 S108P possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tkfc G A 19: 10,597,378 A166V probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Trim47 A G 11: 116,106,413 F505S probably damaging Het
Tti2 T C 8: 31,151,309 F154L possibly damaging Het
Ubap2l C T 3: 90,038,964 G111D possibly damaging Het
Usp9y A T Y: 1,381,277 I848N possibly damaging Het
Veph1 T C 3: 66,061,102 Y740C probably damaging Het
Vmn2r114 T A 17: 23,291,109 H799L possibly damaging Het
Wdr31 T A 4: 62,455,943 M270L probably benign Het
Zfp26 A G 9: 20,436,617 S884P probably benign Het
Zswim6 T A 13: 107,773,395 noncoding transcript Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116311329 missense probably benign 0.39
IGL00916:Mast2 APN 4 116327633 missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116319764 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116307987 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116312846 splice site probably benign
R0883:Mast2 UTSW 4 116311767 missense probably damaging 1.00
R1447:Mast2 UTSW 4 116312013 missense probably benign 0.02
R1449:Mast2 UTSW 4 116309013 missense probably damaging 1.00
R1473:Mast2 UTSW 4 116311955 missense probably damaging 1.00
R1491:Mast2 UTSW 4 116316491 missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116430519 missense probably benign 0.17
R1654:Mast2 UTSW 4 116316550 critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116306959 missense probably damaging 1.00
R1807:Mast2 UTSW 4 116310741 splice site probably benign
R1981:Mast2 UTSW 4 116314840 missense probably damaging 1.00
R2157:Mast2 UTSW 4 116322283 missense probably damaging 1.00
R3409:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3435:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3953:Mast2 UTSW 4 116313729 missense probably damaging 1.00
R4056:Mast2 UTSW 4 116337501 splice site probably benign
R4153:Mast2 UTSW 4 116315963 missense possibly damaging 0.91
R4648:Mast2 UTSW 4 116314839 nonsense probably null
R4671:Mast2 UTSW 4 116308650 missense probably damaging 1.00
R4911:Mast2 UTSW 4 116353057 missense probably benign 0.36
R4980:Mast2 UTSW 4 116317751 missense probably damaging 1.00
R5322:Mast2 UTSW 4 116333411 critical splice donor site probably null
R5462:Mast2 UTSW 4 116307458 missense probably damaging 0.99
R5586:Mast2 UTSW 4 116435563 missense probably damaging 0.99
R5750:Mast2 UTSW 4 116308889 intron probably benign
R5771:Mast2 UTSW 4 116333425 missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116314838 missense probably damaging 1.00
R6230:Mast2 UTSW 4 116326098 missense probably damaging 1.00
R6347:Mast2 UTSW 4 116317732 missense probably damaging 1.00
R6527:Mast2 UTSW 4 116314939 missense probably damaging 0.99
R6619:Mast2 UTSW 4 116316497 nonsense probably null
R7070:Mast2 UTSW 4 116310855 missense probably benign 0.03
R7303:Mast2 UTSW 4 116308311 missense possibly damaging 0.63
X0003:Mast2 UTSW 4 116307647 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGGACTGGATGGAGAACAATTATC -3'
(R):5'- TGAGAACTCATGCTAGACAGAC -3'

Sequencing Primer
(F):5'- ACAGTTTGATCCTCAGGCAG -3'
(R):5'- CATGCTAGACAGACAATATCTTGTG -3'
Posted On2014-09-17