Incidental Mutation 'R2122:Blvra'
ID229548
Institutional Source Beutler Lab
Gene Symbol Blvra
Ensembl Gene ENSMUSG00000001999
Gene Namebiliverdin reductase A
Synonyms0610006A11Rik, Blvr, 2500001N03Rik
MMRRC Submission 040126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R2122 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location127070665-127097084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 127086897 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 102 (S102A)
Ref Sequence ENSEMBL: ENSMUSP00000118278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002064] [ENSMUST00000110389] [ENSMUST00000135529] [ENSMUST00000142737]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002064
AA Change: S102A

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002064
Gene: ENSMUSG00000001999
AA Change: S102A

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 2.1e-22 PFAM
Pfam:Biliv-reduc_cat 132 244 2.6e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110389
AA Change: S102A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106019
Gene: ENSMUSG00000001999
AA Change: S102A

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 9.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135529
AA Change: S102A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118278
Gene: ENSMUSG00000001999
AA Change: S102A

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 123 1e-22 PFAM
transmembrane domain 125 147 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142737
AA Change: S102A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116825
Gene: ENSMUSG00000001999
AA Change: S102A

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 9 124 4.7e-24 PFAM
Pfam:NAD_binding_3 15 122 1.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142861
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: This locus controls electrophoretic mobility of biliverdin reductase. The a allele determines a slowly migrating band in C3H/He, C57BL/H and 101/H; the b allele determines a fast band in BALB/c, CBA/Ca, TFH/H and SM/J. Heterozygotes have both parental bands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 G T 7: 120,519,961 G975V probably damaging Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Actl10 G A 2: 154,552,233 R35H probably damaging Het
Adamts12 C T 15: 11,310,579 T974I probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Arhgef7 A T 8: 11,728,256 N2I possibly damaging Het
Btn1a1 A G 13: 23,461,521 L226P probably damaging Het
C2cd4d G T 3: 94,363,618 E64* probably null Het
Ccna2 A G 3: 36,568,726 V209A probably damaging Het
Cd55 T A 1: 130,459,617 D148V possibly damaging Het
Cdh2 G A 18: 16,774,543 P46L probably benign Het
Cldn11 A G 3: 31,163,151 Y156C probably damaging Het
Cmtm2a T C 8: 104,293,023 R12G possibly damaging Het
Cog2 T C 8: 124,528,985 S104P possibly damaging Het
Col4a3 T G 1: 82,654,957 F184V unknown Het
Col4a4 T A 1: 82,456,871 D1406V unknown Het
Col6a1 T C 10: 76,721,498 T207A probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dcdc2a T G 13: 25,119,285 S266R possibly damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Eif2ak4 T A 2: 118,455,793 V1063E probably damaging Het
Enpp2 A T 15: 54,897,792 Y44* probably null Het
Ep400 A T 5: 110,708,850 probably benign Het
Exoc6b A G 6: 84,621,482 M779T probably benign Het
F13a1 T A 13: 37,025,679 Y104F probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Fscn3 A G 6: 28,430,389 D186G probably benign Het
Gm5773 G A 3: 93,773,317 G99R possibly damaging Het
Grk1 A T 8: 13,405,221 Y35F probably benign Het
Heatr1 T C 13: 12,403,264 V359A probably benign Het
Hfm1 A G 5: 106,896,255 S567P probably damaging Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Kctd5 T C 17: 24,055,966 T212A probably benign Het
Krtap5-5 A T 7: 142,229,503 C137S unknown Het
Lrp2 T C 2: 69,483,707 T2227A probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Map1a T A 2: 121,299,446 Y248N probably damaging Het
Mdc1 C T 17: 35,847,943 A405V probably benign Het
Mfsd4b1 T C 10: 40,002,651 K417E possibly damaging Het
Mroh2a T C 1: 88,256,754 V1453A probably benign Het
Myh11 T C 16: 14,218,004 E1027G probably damaging Het
Nudt6 A C 3: 37,412,405 F80L probably benign Het
Nxph1 A G 6: 9,247,791 K254R probably damaging Het
Obsl1 C T 1: 75,493,883 R1043H probably benign Het
Olfr17 A T 7: 107,098,109 I215F probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Phldb2 T A 16: 45,762,941 I1065F probably damaging Het
Ppp1r3a A T 6: 14,721,875 N317K possibly damaging Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Pum1 C A 4: 130,669,270 T112K possibly damaging Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Reg3a T C 6: 78,381,136 C17R possibly damaging Het
Ripor2 A G 13: 24,713,718 S800G probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Rnf31 A G 14: 55,596,197 D554G probably damaging Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sacs A T 14: 61,212,316 Q3937L probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc20a1 T G 2: 129,199,819 I34S possibly damaging Het
Slc25a30 A G 14: 75,770,218 S116P possibly damaging Het
Speer4c T A 5: 15,714,117 D29V possibly damaging Het
Stk40 C T 4: 126,128,847 T138I probably benign Het
Susd3 A G 13: 49,231,150 Y254H probably damaging Het
Tanc2 T C 11: 105,895,949 L858P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tfpt C T 7: 3,628,931 R60Q probably damaging Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Tnfsf9 A T 17: 57,107,316 probably null Het
Ube3c T C 5: 29,619,606 I543T probably benign Het
Ugt1a2 C A 1: 88,201,013 S126Y possibly damaging Het
Vmn1r180 T A 7: 23,953,141 L243Q probably damaging Het
Vmn2r15 A C 5: 109,286,456 V794G probably damaging Het
Vmn2r24 A G 6: 123,815,394 D560G possibly damaging Het
Wdr11 G A 7: 129,631,766 C1028Y probably damaging Het
Zfp318 A G 17: 46,413,371 D2100G probably benign Het
Zfyve16 A T 13: 92,519,483 Y789* probably null Het
Other mutations in Blvra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Blvra APN 2 127082951 missense probably damaging 1.00
R1084:Blvra UTSW 2 127080653 missense probably benign 0.00
R1932:Blvra UTSW 2 127095148 missense probably damaging 1.00
R2114:Blvra UTSW 2 127086069 nonsense probably null
R2115:Blvra UTSW 2 127086069 nonsense probably null
R2117:Blvra UTSW 2 127086069 nonsense probably null
R3734:Blvra UTSW 2 127090255 intron probably benign
R3847:Blvra UTSW 2 127095191 missense probably damaging 0.96
R4110:Blvra UTSW 2 127095155 missense probably damaging 1.00
R4533:Blvra UTSW 2 127090384 unclassified probably null
R4620:Blvra UTSW 2 127096965 missense probably damaging 1.00
R4702:Blvra UTSW 2 127092062 missense probably benign 0.01
R5921:Blvra UTSW 2 127087363 intron probably benign
R6322:Blvra UTSW 2 127080539 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CTTGGCTGTTTGTGACACTC -3'
(R):5'- AAAGCTAAGAGTCCACAGGC -3'

Sequencing Primer
(F):5'- TTGTGACACTCGTACACAGG -3'
(R):5'- TAAGAGTCCACAGGCTCCTCTG -3'
Posted On2014-09-17