Incidental Mutation 'R2124:Abcg5'
ID229704
Institutional Source Beutler Lab
Gene Symbol Abcg5
Ensembl Gene ENSMUSG00000040505
Gene NameATP binding cassette subfamily G member 5
SynonymsSterolin-1, cmp, trac
MMRRC Submission 040127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2124 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84658234-84683011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 84671147 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 294 (E294D)
Ref Sequence ENSEMBL: ENSMUSP00000069495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066175] [ENSMUST00000163375]
Predicted Effect probably benign
Transcript: ENSMUST00000066175
AA Change: E294D

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069495
Gene: ENSMUSG00000040505
AA Change: E294D

DomainStartEndE-ValueType
AAA 79 271 2.28e-11 SMART
Pfam:ABC2_membrane 367 581 1.3e-24 PFAM
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163375
SMART Domains Protein: ENSMUSP00000130783
Gene: ENSMUSG00000040505

DomainStartEndE-ValueType
Pfam:ABC_tran 1 134 7.8e-17 PFAM
Pfam:ABC2_membrane 195 409 1.4e-23 PFAM
transmembrane domain 449 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172439
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (80/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily, and functions as a half-transporter to limit intestinal absorption and promote biliary excretion of sterols. Disruption of this gene in mice results in thrombocytopenia, prolonged bleeding times, anemia, leukopenia, infertility, shortened life span and cardiomyopathy. Mice lacking this gene show symptoms of sitosterolemia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygotes for a null allele show hyperabsorption of dietary plant sterols and sitosterolemia. Spontaneous mutants are small, infertile and hunched and display anemia, leukopenia, macrothrombocytopenia, other hematologic defects, cardiomyopathy, high plasma phytosterol levels and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Adgrg6 T C 10: 14,467,186 D339G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap3 A C 18: 37,973,350 L1480R probably damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Aspg G A 12: 112,121,174 V8I probably benign Het
Aven T A 2: 112,625,196 W26R probably damaging Het
Car4 T A 11: 84,964,085 probably benign Het
Cd163 C T 6: 124,318,856 R720C probably damaging Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cdh3 A T 8: 106,552,888 H712L probably damaging Het
Cdr2 T C 7: 120,982,027 E9G probably damaging Het
Chrnb2 T C 3: 89,769,341 probably benign Het
Col4a2 C A 8: 11,416,070 P443Q probably damaging Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Ddias T C 7: 92,858,256 Q817R probably benign Het
Ddx6 C T 9: 44,624,519 Q182* probably null Het
Dhrs7 A G 12: 72,653,177 I227T probably damaging Het
Dhx8 A T 11: 101,762,245 M970L probably damaging Het
Dnah7a A T 1: 53,496,942 D2647E possibly damaging Het
Dstyk G A 1: 132,453,119 G451R possibly damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Efl1 C T 7: 82,692,913 R510C probably damaging Het
Eif4g3 A G 4: 138,184,742 E1409G probably damaging Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fcgbp T C 7: 28,092,019 Y902H probably benign Het
Fgf18 A C 11: 33,118,003 F129C probably damaging Het
Gbp9 T A 5: 105,094,543 D110V probably damaging Het
Gm10477 A G X: 56,524,832 K31E probably damaging Het
Gm10542 T A 18: 44,201,288 W9R probably null Het
Gm7173 T C X: 79,510,321 I267V probably benign Het
Gpaa1 A G 15: 76,333,352 Y330C probably damaging Het
Hectd4 T C 5: 121,318,639 L689P probably damaging Het
Hoxd3 C A 2: 74,744,234 P75T possibly damaging Het
Ikbkb A G 8: 22,666,020 L570P probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints6l T A X: 56,504,868 S718T probably benign Het
Jaml T A 9: 45,101,064 I283N probably damaging Het
Kidins220 G A 12: 25,041,303 probably null Het
Kif1b T C 4: 149,222,296 D869G probably benign Het
Loxl2 T C 14: 69,692,410 Y746H probably benign Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mageb5 A G X: 91,780,095 I226T probably damaging Het
Msantd2 C T 9: 37,522,931 R357W probably damaging Het
Neb A G 2: 52,264,064 F2345S probably damaging Het
Olfr866 T G 9: 20,027,501 I146L probably benign Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Plekhg4 TAGTCGATGCCCGAGTC TAGTC 8: 105,376,452 probably benign Het
Prkdc T C 16: 15,719,433 V1716A probably benign Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Rasgrp2 T A 19: 6,404,395 M156K probably benign Het
Rims1 T A 1: 22,404,508 R200* probably null Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
Sall3 C T 18: 80,971,797 G972D probably benign Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Scamp5 C A 9: 57,447,225 V49F possibly damaging Het
Sdk1 C A 5: 142,185,188 D1935E possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Syt16 T A 12: 74,238,235 S401T probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tbcd A G 11: 121,603,320 Y983C probably damaging Het
Tenm3 A G 8: 48,417,006 probably null Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Top2a T C 11: 99,004,228 I849V probably benign Het
Ttn A G 2: 76,794,448 V13516A probably damaging Het
Uxs1 A G 1: 43,774,846 L77P probably damaging Het
Vmn2r121 A T X: 124,133,742 probably null Het
Vmn2r84 A C 10: 130,391,231 M246R probably damaging Het
Vps13b T A 15: 35,646,080 N1443K probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp616 A G 11: 74,083,043 probably null Het
Zmym1 T C 4: 127,049,570 T244A probably benign Het
Other mutations in Abcg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Abcg5 APN 17 84664847 missense possibly damaging 0.73
IGL01844:Abcg5 APN 17 84682025 missense probably damaging 1.00
IGL02002:Abcg5 APN 17 84682051 nonsense probably null
IGL02116:Abcg5 APN 17 84673590 missense possibly damaging 0.67
IGL02339:Abcg5 APN 17 84673604 missense possibly damaging 0.95
IGL02568:Abcg5 APN 17 84670399 missense probably damaging 0.99
PIT4142001:Abcg5 UTSW 17 84673594 missense possibly damaging 0.59
R0539:Abcg5 UTSW 17 84669075 missense probably benign 0.01
R1104:Abcg5 UTSW 17 84682049 missense possibly damaging 0.78
R1795:Abcg5 UTSW 17 84673579 missense probably damaging 1.00
R1956:Abcg5 UTSW 17 84670375 missense probably damaging 1.00
R1970:Abcg5 UTSW 17 84673602 frame shift probably null
R2007:Abcg5 UTSW 17 84669920 missense probably damaging 1.00
R2118:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2120:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2121:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2122:Abcg5 UTSW 17 84671147 missense probably benign 0.06
R2858:Abcg5 UTSW 17 84670220 critical splice donor site probably null
R3121:Abcg5 UTSW 17 84658663 missense probably benign 0.33
R4694:Abcg5 UTSW 17 84672158 missense probably damaging 1.00
R4835:Abcg5 UTSW 17 84658648 missense possibly damaging 0.95
R4963:Abcg5 UTSW 17 84660141 nonsense probably null
R5187:Abcg5 UTSW 17 84658564 missense probably damaging 1.00
R5348:Abcg5 UTSW 17 84671206 missense possibly damaging 0.92
R5445:Abcg5 UTSW 17 84671129 missense probably damaging 1.00
R5580:Abcg5 UTSW 17 84660154 missense probably damaging 1.00
R5807:Abcg5 UTSW 17 84672291 missense probably damaging 0.99
R6007:Abcg5 UTSW 17 84668964 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAGAAGAGCCGGTGTCATC -3'
(R):5'- CTGGGACTCAGAGGCATATAAC -3'

Sequencing Primer
(F):5'- TGATCCCTAGAAGCCATGTCG -3'
(R):5'- TGGGACTCAGAGGCATATAACAACAC -3'
Posted On2014-09-17