Incidental Mutation 'R2125:Lama2'
ID229779
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 040128-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R2125 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 27044453 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 193 (Y193*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
Predicted Effect probably null
Transcript: ENSMUST00000092639
AA Change: Y2181*
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: Y2181*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000219763
AA Change: Y193*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A T 7: 28,158,022 Y2265F probably benign Het
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Abcb10 A C 8: 123,965,092 V378G probably benign Het
Ackr2 C T 9: 121,908,786 R76* probably null Het
Acly T C 11: 100,523,496 T35A probably benign Het
Acp7 A C 7: 28,629,549 F69V probably damaging Het
Acsl3 T A 1: 78,681,961 I110N probably damaging Het
Adam5 C T 8: 24,815,118 V107M probably damaging Het
Adck2 T C 6: 39,575,142 V281A probably benign Het
Adgrv1 A G 13: 81,419,535 V5173A probably benign Het
Adgrv1 A T 13: 81,419,950 S5035T probably benign Het
AI314180 T C 4: 58,833,978 H834R probably benign Het
Arl10 T A 13: 54,579,124 probably null Het
B3gnt3 A G 8: 71,693,358 W176R probably damaging Het
B4galt4 T C 16: 38,765,938 I3T probably damaging Het
Casr T C 16: 36,495,252 I819V possibly damaging Het
Cdh1 T C 8: 106,656,840 V237A probably damaging Het
Col22a1 G A 15: 71,848,577 R605C unknown Het
Crlf3 A G 11: 80,059,255 V183A probably benign Het
Crtac1 C A 19: 42,323,732 V181L probably damaging Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnhd1 A T 7: 105,677,971 H709L probably benign Het
Dopey1 A G 9: 86,521,046 Y1431C probably damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Entpd3 T C 9: 120,555,654 I99T probably damaging Het
Epha6 T C 16: 59,682,688 D952G probably damaging Het
Exoc6 T C 19: 37,590,941 L429P probably damaging Het
F13a1 A G 13: 36,892,841 S625P probably benign Het
Fcho2 T C 13: 98,775,898 N240S possibly damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Fmo6 A T 1: 162,929,958 M82K possibly damaging Het
Gabrr2 T G 4: 33,095,548 I479R probably damaging Het
Gm14409 C A 2: 177,265,402 C101F probably damaging Het
Gnl2 T A 4: 125,053,485 F633L probably benign Het
Greb1l C T 18: 10,511,422 S648F probably damaging Het
Gsap T A 5: 21,242,813 C290S probably damaging Het
Gusb A G 5: 129,999,447 V268A probably benign Het
H2-D1 G A 17: 35,264,115 probably null Het
Hebp2 T A 10: 18,541,260 E164D probably benign Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hoxc13 G T 15: 102,927,223 R262L probably damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Impg2 T A 16: 56,265,064 Y1045N probably damaging Het
Kcnk1 A G 8: 125,995,656 E66G probably damaging Het
Klkb1 A G 8: 45,275,504 V406A possibly damaging Het
Klra10 G A 6: 130,279,278 R138W probably damaging Het
Larp7 T C 3: 127,543,130 T428A probably benign Het
Lipg T C 18: 74,945,885 N432S probably benign Het
Loxl1 T C 9: 58,293,712 D489G probably damaging Het
Lrguk A G 6: 34,092,902 K571E probably benign Het
Map3k13 C T 16: 21,892,144 T59I probably benign Het
Mertk T A 2: 128,762,138 D397E probably benign Het
Mgat3 G A 15: 80,211,886 V305I probably benign Het
Mkl2 T C 16: 13,400,804 V449A possibly damaging Het
Mybpc1 G A 10: 88,573,437 Q66* probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Ndufaf3 C T 9: 108,566,737 R31Q probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrxn3 A G 12: 89,260,520 probably null Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1257 A G 2: 89,881,638 M271V probably benign Het
Pcsk4 T C 10: 80,323,879 M379V probably benign Het
Pdzd2 A T 15: 12,373,590 V2153E probably benign Het
Pkd2l1 T C 19: 44,154,500 D427G possibly damaging Het
Plcd4 A G 1: 74,565,152 Y763C probably damaging Het
Plekhh1 T C 12: 79,079,000 F1270S probably damaging Het
Pmfbp1 T C 8: 109,520,273 V259A probably damaging Het
Ptprg T C 14: 12,179,283 S767P possibly damaging Het
Rabl3 T G 16: 37,556,813 probably null Het
Rffl T A 11: 82,818,438 H53L probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rtl1 C T 12: 109,593,921 V495I possibly damaging Het
Scaf11 A T 15: 96,419,315 D789E possibly damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Siglech T A 7: 55,771,686 F190I probably benign Het
Slc22a22 C A 15: 57,254,240 A302S probably damaging Het
Slc46a3 T A 5: 147,879,144 T458S probably benign Het
Spta1 G T 1: 174,208,344 R1072L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tfip11 T C 5: 112,335,663 V648A possibly damaging Het
Thumpd3 T C 6: 113,066,788 V388A probably benign Het
Tmem131l C T 3: 83,942,751 probably null Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttn A T 2: 76,890,092 probably null Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vtn A G 11: 78,500,223 T210A probably damaging Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTAGATCTGACCAAAGCATAATG -3'
(R):5'- AGGATGACAGTCTGCTACTTTGG -3'

Sequencing Primer
(F):5'- CACTGACAAAAAGAGATATGCCTG -3'
(R):5'- GACAGTCTGCTACTTTGGAATATAC -3'
Posted On2014-09-17