Incidental Mutation 'R0158:Ap1g1'
ID22981
Institutional Source Beutler Lab
Gene Symbol Ap1g1
Ensembl Gene ENSMUSG00000031731
Gene Nameadaptor protein complex AP-1, gamma 1 subunit
SynonymsD8Ertd374e, Adtg, gamma-adaptin
MMRRC Submission 038438-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0158 (G1)
Quality Score225
Status Validated (trace)
Chromosome8
Chromosomal Location109778554-109864204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109855635 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 724 (S724P)
Ref Sequence ENSEMBL: ENSMUSP00000034171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034171] [ENSMUST00000093157]
PDB Structure
GAMMA-ADAPTIN APPENDAGE DOMAIN FROM CLATHRIN ADAPTOR AP1 [X-RAY DIFFRACTION]
GAMMA-ADAPTIN APPENDAGE DOMAIN FROM CLATHRIN ADAPTOR AP1, L762E MUTANT [X-RAY DIFFRACTION]
GAMMA-ADAPTIN APPENDAGE DOMAIN FROM CLATHRIN ADAPTOR AP1 A753D MUTANT [X-RAY DIFFRACTION]
AP1 CLATHRIN ADAPTOR CORE [X-RAY DIFFRACTION]
On the Routine Use of Soft X-Rays in Macromolecular Crystallography, Part III- The Optimal Data Collection Wavelength [X-RAY DIFFRACTION]
Crystal structure of computationally redesigned gamma-adaptin appendage domain forming a symmetric homodimer [X-RAY DIFFRACTION]
Structural basis for recruitment and activation of the AP-1 clathrin adaptor complex by Arf1 [X-RAY DIFFRACTION]
Crystal structure of the human BST2 cytoplasmic domain and the HIV-1 Vpu cytoplasmic domain bound to the clathrin adaptor protein complex 1 (AP1) core [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034171
AA Change: S724P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731
AA Change: S724P

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093157
AA Change: S727P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731
AA Change: S727P

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173980
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 93% (79/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality before implantation. Heterozygotes display slow postnatal weight gain, decreased CD4-positive, alpha beta T cell number in the thymus, and decreased body size up to 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T G 1: 26,683,951 H716P probably damaging Het
9530053A07Rik A G 7: 28,155,492 I1848V probably damaging Het
Abcf3 C T 16: 20,552,566 R437C probably damaging Het
Abhd3 A G 18: 10,647,840 Y315H possibly damaging Het
Adam19 C T 11: 46,143,034 P891L probably damaging Het
Ampd1 T A 3: 103,091,730 Y400* probably null Het
BC067074 T A 13: 113,369,153 L2272* probably null Het
Bst2 T A 8: 71,537,217 T71S possibly damaging Het
C3 A G 17: 57,224,851 probably null Het
Cacna2d1 C A 5: 16,361,817 probably benign Het
Cacna2d4 C T 6: 119,236,748 H43Y possibly damaging Het
Ccdc71 T G 9: 108,464,137 V383G probably benign Het
Cd109 A T 9: 78,688,932 Q849L possibly damaging Het
Cdkn2a A T 4: 89,276,767 H115Q possibly damaging Het
Ces1e T C 8: 93,219,429 E161G probably benign Het
Cggbp1 C T 16: 64,855,838 S89L possibly damaging Het
Crocc A T 4: 141,042,242 probably benign Het
Eef1akmt3 G A 10: 127,033,273 Q111* probably null Het
Exoc7 T C 11: 116,295,292 N361S probably benign Het
Fat2 G T 11: 55,296,185 S1278R probably benign Het
Fbxo42 A G 4: 141,200,329 N640S probably benign Het
Fbxw25 A G 9: 109,654,652 V164A possibly damaging Het
Foxs1 T C 2: 152,932,410 E241G probably damaging Het
Fras1 A T 5: 96,776,634 I3645F possibly damaging Het
Gm14496 T A 2: 181,997,413 V432E probably benign Het
Herc1 T A 9: 66,495,921 L4374* probably null Het
Hist1h3b T A 13: 23,752,710 C111S probably damaging Het
Ift122 T C 6: 115,924,484 probably benign Het
Itgav C A 2: 83,792,037 N654K probably benign Het
Itih5 T C 2: 10,234,992 probably benign Het
Jak2 C A 19: 29,311,757 T1103K probably benign Het
Kcnc4 C A 3: 107,458,604 C96F probably benign Het
Med13l C A 5: 118,742,449 S1202Y unknown Het
Mefv T C 16: 3,715,456 E317G possibly damaging Het
Ncoa2 T C 1: 13,152,384 T1226A probably benign Het
Nktr C T 9: 121,750,691 probably benign Het
Nudt5 G A 2: 5,862,303 V61M probably damaging Het
Olfr33 C T 7: 102,713,955 A153T probably benign Het
Palm2 A G 4: 57,709,649 D198G possibly damaging Het
Papd5 G A 8: 88,250,743 G391D probably damaging Het
Pcdhb2 A C 18: 37,297,230 Y752S probably damaging Het
Pcnx4 A G 12: 72,556,302 D446G probably benign Het
Pnp2 G A 14: 50,964,304 R249H probably damaging Het
Rgs3 A T 4: 62,623,884 I32F probably damaging Het
Rnf139 A G 15: 58,898,878 T251A probably benign Het
Rnf41 A G 10: 128,438,235 E252G probably damaging Het
Rxfp2 T A 5: 150,051,628 F220Y probably benign Het
Sdcbp A G 4: 6,379,042 D43G possibly damaging Het
Serpina3f A G 12: 104,217,008 D43G probably damaging Het
Sftpc T C 14: 70,521,447 K154R probably null Het
Simc1 A G 13: 54,524,717 T293A probably benign Het
Skint6 A T 4: 113,184,814 probably benign Het
Slc6a15 T C 10: 103,389,347 probably benign Het
Ston2 A T 12: 91,740,602 I78N probably damaging Het
Taok3 T C 5: 117,217,242 probably null Het
Tiam1 C T 16: 89,793,001 probably benign Het
Tnfsf15 T C 4: 63,729,992 H137R possibly damaging Het
Tpte G A 8: 22,327,739 R247H possibly damaging Het
Trim2 T C 3: 84,210,169 probably benign Het
Ulk1 A T 5: 110,788,944 probably benign Het
Utp4 T G 8: 106,913,386 H442Q probably null Het
Vmn1r193 T A 13: 22,219,628 I65F probably damaging Het
Vps54 A T 11: 21,306,962 Q690L probably damaging Het
Ybx2 T C 11: 69,940,319 probably benign Het
Zbtb38 C T 9: 96,686,940 G697D possibly damaging Het
Zfp202 C T 9: 40,208,916 Q218* probably null Het
Zfp820 G A 17: 21,819,819 T176I probably benign Het
Other mutations in Ap1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Ap1g1 APN 8 109832782 missense possibly damaging 0.85
IGL01907:Ap1g1 APN 8 109843343 splice site probably benign
IGL02248:Ap1g1 APN 8 109863433 utr 3 prime probably benign
IGL02548:Ap1g1 APN 8 109849622 missense probably damaging 1.00
Collapse UTSW 8 109828336 critical splice donor site probably null
Deflate UTSW 8 109851132 critical splice donor site probably null
depress UTSW 8 109838920 missense probably damaging 1.00
R0226:Ap1g1 UTSW 8 109855062 missense probably benign 0.39
R0254:Ap1g1 UTSW 8 109803117 missense probably benign 0.01
R0315:Ap1g1 UTSW 8 109819035 missense probably benign
R0380:Ap1g1 UTSW 8 109803164 splice site probably benign
R0471:Ap1g1 UTSW 8 109853643 missense possibly damaging 0.90
R0508:Ap1g1 UTSW 8 109837732 splice site probably benign
R0837:Ap1g1 UTSW 8 109851065 missense probably damaging 1.00
R1025:Ap1g1 UTSW 8 109818939 missense probably benign 0.24
R1700:Ap1g1 UTSW 8 109853612 missense probably damaging 1.00
R1759:Ap1g1 UTSW 8 109833221 missense probably damaging 1.00
R1809:Ap1g1 UTSW 8 109833182 splice site probably benign
R2161:Ap1g1 UTSW 8 109844354 missense probably damaging 1.00
R3428:Ap1g1 UTSW 8 109843448 missense probably damaging 1.00
R3772:Ap1g1 UTSW 8 109837786 missense probably damaging 1.00
R3897:Ap1g1 UTSW 8 109854999 missense probably damaging 0.97
R4244:Ap1g1 UTSW 8 109833490 missense probably benign 0.04
R4714:Ap1g1 UTSW 8 109829620 missense probably damaging 0.98
R4736:Ap1g1 UTSW 8 109855082 missense possibly damaging 0.93
R5173:Ap1g1 UTSW 8 109851132 critical splice donor site probably null
R5185:Ap1g1 UTSW 8 109863326 utr 3 prime probably benign
R5435:Ap1g1 UTSW 8 109838920 missense probably damaging 1.00
R5685:Ap1g1 UTSW 8 109837783 missense probably damaging 0.99
R5824:Ap1g1 UTSW 8 109838912 splice site probably null
R5867:Ap1g1 UTSW 8 109818982 missense probably damaging 1.00
R6339:Ap1g1 UTSW 8 109844368 missense possibly damaging 0.85
R6978:Ap1g1 UTSW 8 109828336 critical splice donor site probably null
R7532:Ap1g1 UTSW 8 109860164 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCCTCTCTTCAATGACATCGC -3'
(R):5'- CGACTACAATGGCATGTTTTGATGACC -3'

Sequencing Primer
(F):5'- TTCAATGACATCGCTCCAGG -3'
(R):5'- ATGGCATGTTTTGATGACCTCAATG -3'
Posted On2013-04-16