Incidental Mutation 'R2126:Rif1'
ID229841
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Namereplication timing regulatory factor 1
Synonyms6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission 040129-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2126 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location52072832-52122383 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GCCACCA to GCCA at 52110324 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
Predicted Effect probably benign
Transcript: ENSMUST00000069794
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112693
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Acat3 C T 17: 12,927,407 A230T probably benign Het
Acsl1 C A 8: 46,533,626 P650Q probably benign Het
Adgrl3 T A 5: 81,512,536 I316N probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
AI429214 T A 8: 36,994,208 V170E probably benign Het
Akap13 G A 7: 75,725,304 G1895S possibly damaging Het
Alpk2 G A 18: 65,350,368 Q190* probably null Het
Aox3 C A 1: 58,158,216 Q574K probably benign Het
Apeh A G 9: 108,085,667 Y702H probably damaging Het
Aqp11 A G 7: 97,737,485 I151T probably benign Het
Arhgap28 A G 17: 67,869,015 V363A possibly damaging Het
Arhgef18 A G 8: 3,451,939 N699S probably damaging Het
Asnsd1 A G 1: 53,347,317 S384P probably benign Het
Atl1 G T 12: 69,931,657 probably null Het
Atp13a2 A T 4: 140,995,391 D203V possibly damaging Het
Axdnd1 A T 1: 156,333,214 N164K probably benign Het
Bnipl T A 3: 95,245,683 I162F probably damaging Het
Cacna1d A T 14: 30,123,163 L655I probably damaging Het
Canx T C 11: 50,304,358 I294M probably damaging Het
Casz1 T C 4: 148,946,064 F1180S probably damaging Het
Cav3 T C 6: 112,472,383 Y121H probably benign Het
Cd4 A C 6: 124,870,536 S222A probably benign Het
Cds1 T C 5: 101,812,550 I289T probably benign Het
Cep112 T C 11: 108,508,258 F328L probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap44 A T 16: 44,410,475 D273V probably benign Het
Clec7a C T 6: 129,470,955 G49D probably benign Het
Col22a1 G A 15: 71,857,253 Q599* probably null Het
Col6a5 T A 9: 105,945,600 H186L unknown Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnajc10 G A 2: 80,350,734 probably null Het
Edem3 A T 1: 151,794,731 H337L possibly damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Ercc6l2 G A 13: 63,848,771 V365I probably damaging Het
Fam129a A C 1: 151,696,135 E277A probably damaging Het
Fam129a A G 1: 151,709,133 I494V possibly damaging Het
Fan1 T C 7: 64,346,888 E978G probably damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Gaa G A 11: 119,270,282 W50* probably null Het
Gm10032 T C 14: 66,792,778 noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,845,249 probably null Het
Gprc5b G T 7: 118,984,175 P157Q probably damaging Het
Gsdmc3 G A 15: 63,858,534 Q394* probably null Het
Gucd1 A G 10: 75,512,088 S38P probably damaging Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hmx3 G C 7: 131,544,549 V329L possibly damaging Het
Hnrnpul2 A T 19: 8,824,438 R337* probably null Het
Idua T A 5: 108,681,438 H368Q possibly damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl30 T A 1: 91,358,777 probably null Het
Lasp1 T A 11: 97,836,134 D227E probably benign Het
Lhx6 A G 2: 36,091,324 I85T possibly damaging Het
Limch1 A G 5: 67,029,760 D840G probably damaging Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrrtm4 A T 6: 80,021,739 I44F probably damaging Het
Ltbp2 T C 12: 84,785,709 probably null Het
Lyg1 T C 1: 37,950,674 Y44C probably damaging Het
Maats1 T C 16: 38,341,762 T6A probably benign Het
Map1a A G 2: 121,298,641 I129V probably damaging Het
Med27 C T 2: 29,524,430 Q150* probably null Het
Ms4a5 A T 19: 11,279,368 I55N probably damaging Het
Muc5ac T C 7: 141,810,742 S2597P possibly damaging Het
Mxd1 A C 6: 86,651,440 probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrn1 A C 13: 36,730,206 V34G probably damaging Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1099 T C 2: 86,959,098 Y120C possibly damaging Het
Olfr1302 A G 2: 111,780,496 M59V probably damaging Het
Olfr679 A G 7: 105,086,615 T300A probably damaging Het
Olfr690 C T 7: 105,329,252 W313* probably null Het
Olfr722 A G 14: 49,895,067 I245T probably benign Het
Olfr887 G T 9: 38,085,276 V147L probably benign Het
Pdia4 A T 6: 47,796,837 V526E probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Pgk2 A G 17: 40,207,509 F343L probably damaging Het
Piwil1 T C 5: 128,754,096 V827A probably damaging Het
Plag1 A T 4: 3,904,169 Y341N possibly damaging Het
Plch2 T C 4: 154,998,999 E393G probably damaging Het
Ptprg T A 14: 12,154,355 M692K probably benign Het
Rassf8 G A 6: 145,815,182 R78H probably benign Het
Rnf213 A G 11: 119,450,201 Q3556R probably damaging Het
Rpa2 T C 4: 132,768,788 probably null Het
Rpe T G 1: 66,715,980 F174V possibly damaging Het
Sbf2 T C 7: 110,560,295 D36G probably damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Slc24a4 T C 12: 102,222,759 V151A probably damaging Het
Slc30a8 A T 15: 52,295,934 M17L probably benign Het
Slit3 T C 11: 35,688,679 Y1228H probably damaging Het
Smad4 G A 18: 73,662,744 T193M probably benign Het
Smtn T A 11: 3,530,045 H392L probably benign Het
St8sia3 A G 18: 64,269,674 D128G probably damaging Het
Sucla2 A T 14: 73,592,668 M382L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tex44 T C 1: 86,427,089 L240P probably benign Het
Tns4 A T 11: 99,080,078 probably null Het
Trappc10 A T 10: 78,203,924 V731E possibly damaging Het
Ttf1 A G 2: 29,071,345 K582E probably damaging Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttll6 A G 11: 96,147,532 E402G probably damaging Het
Ttn A T 2: 76,890,092 probably null Het
Ugt8a T C 3: 125,875,546 D303G probably damaging Het
Ulk1 G T 5: 110,792,436 A373D probably benign Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vmn2r19 T A 6: 123,316,074 D358E possibly damaging Het
Vmn2r88 T C 14: 51,413,807 S201P probably benign Het
Zfp36l2 A G 17: 84,186,975 F78S probably damaging Het
Zfp454 A C 11: 50,873,995 S203R probably benign Het
Zfp616 C A 11: 74,085,403 Q833K probably benign Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Zswim3 T A 2: 164,819,993 I131N probably benign Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0726:Rif1 UTSW 2 52110353 missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 intron probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 intron probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTCGGTGGTCAGCAGTAGTTC -3'
(R):5'- TCTGTTGGGCTGAGCAGATC -3'

Sequencing Primer
(F):5'- GCAGTAGTTCAGTTTCTAATGCCAC -3'
(R):5'- AGCAGATCAGGAGAGTTATTTTCG -3'
Posted On2014-09-17