Incidental Mutation 'R2126:Casz1'
ID229864
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 040129-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.428) question?
Stock #R2126 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148946064 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1180 (F1180S)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222]
Predicted Effect probably benign
Transcript: ENSMUST00000094464
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122222
AA Change: F1180S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: F1180S

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123548
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac A G 3: 60,039,645 T255A possibly damaging Het
Acat3 C T 17: 12,927,407 A230T probably benign Het
Acsl1 C A 8: 46,533,626 P650Q probably benign Het
Adgrl3 T A 5: 81,512,536 I316N probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
AI429214 T A 8: 36,994,208 V170E probably benign Het
Akap13 G A 7: 75,725,304 G1895S possibly damaging Het
Alpk2 G A 18: 65,350,368 Q190* probably null Het
Aox3 C A 1: 58,158,216 Q574K probably benign Het
Apeh A G 9: 108,085,667 Y702H probably damaging Het
Aqp11 A G 7: 97,737,485 I151T probably benign Het
Arhgap28 A G 17: 67,869,015 V363A possibly damaging Het
Arhgef18 A G 8: 3,451,939 N699S probably damaging Het
Asnsd1 A G 1: 53,347,317 S384P probably benign Het
Atl1 G T 12: 69,931,657 probably null Het
Atp13a2 A T 4: 140,995,391 D203V possibly damaging Het
Axdnd1 A T 1: 156,333,214 N164K probably benign Het
Bnipl T A 3: 95,245,683 I162F probably damaging Het
Cacna1d A T 14: 30,123,163 L655I probably damaging Het
Canx T C 11: 50,304,358 I294M probably damaging Het
Cav3 T C 6: 112,472,383 Y121H probably benign Het
Cd4 A C 6: 124,870,536 S222A probably benign Het
Cds1 T C 5: 101,812,550 I289T probably benign Het
Cep112 T C 11: 108,508,258 F328L probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap44 A T 16: 44,410,475 D273V probably benign Het
Clec7a C T 6: 129,470,955 G49D probably benign Het
Col22a1 G A 15: 71,857,253 Q599* probably null Het
Col6a5 T A 9: 105,945,600 H186L unknown Het
Dclk2 C T 3: 86,805,639 R503Q possibly damaging Het
Dnah12 A T 14: 26,724,458 R725* probably null Het
Dnajc10 G A 2: 80,350,734 probably null Het
Edem3 A T 1: 151,794,731 H337L possibly damaging Het
Eif2ak4 A T 2: 118,422,123 H392L probably benign Het
Ercc6l2 G A 13: 63,848,771 V365I probably damaging Het
Fam129a A C 1: 151,696,135 E277A probably damaging Het
Fam129a A G 1: 151,709,133 I494V possibly damaging Het
Fan1 T C 7: 64,346,888 E978G probably damaging Het
Fcrl6 C T 1: 172,599,248 V44M probably benign Het
Gaa G A 11: 119,270,282 W50* probably null Het
Gm10032 T C 14: 66,792,778 noncoding transcript Het
Gm10985 CTCTAT CT 3: 53,845,249 probably null Het
Gprc5b G T 7: 118,984,175 P157Q probably damaging Het
Gsdmc3 G A 15: 63,858,534 Q394* probably null Het
Gucd1 A G 10: 75,512,088 S38P probably damaging Het
Higd1a A T 9: 121,850,247 I58N probably damaging Het
Hmx3 G C 7: 131,544,549 V329L possibly damaging Het
Hnrnpul2 A T 19: 8,824,438 R337* probably null Het
Idua T A 5: 108,681,438 H368Q possibly damaging Het
Ifih1 A G 2: 62,623,467 V218A probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Klhl30 T A 1: 91,358,777 probably null Het
Lasp1 T A 11: 97,836,134 D227E probably benign Het
Lhx6 A G 2: 36,091,324 I85T possibly damaging Het
Limch1 A G 5: 67,029,760 D840G probably damaging Het
Loxl4 C G 19: 42,603,963 E385D probably damaging Het
Lrrtm4 A T 6: 80,021,739 I44F probably damaging Het
Ltbp2 T C 12: 84,785,709 probably null Het
Lyg1 T C 1: 37,950,674 Y44C probably damaging Het
Maats1 T C 16: 38,341,762 T6A probably benign Het
Map1a A G 2: 121,298,641 I129V probably damaging Het
Med27 C T 2: 29,524,430 Q150* probably null Het
Ms4a5 A T 19: 11,279,368 I55N probably damaging Het
Muc5ac T C 7: 141,810,742 S2597P possibly damaging Het
Mxd1 A C 6: 86,651,440 probably null Het
Myo3a A G 2: 22,578,174 D480G probably benign Het
Neb T C 2: 52,310,638 Y343C probably damaging Het
Nrn1 A C 13: 36,730,206 V34G probably damaging Het
Olfr1090 A T 2: 86,754,452 N95K probably benign Het
Olfr1099 T C 2: 86,959,098 Y120C possibly damaging Het
Olfr1302 A G 2: 111,780,496 M59V probably damaging Het
Olfr679 A G 7: 105,086,615 T300A probably damaging Het
Olfr690 C T 7: 105,329,252 W313* probably null Het
Olfr722 A G 14: 49,895,067 I245T probably benign Het
Olfr887 G T 9: 38,085,276 V147L probably benign Het
Pdia4 A T 6: 47,796,837 V526E probably damaging Het
Pdia6 T C 12: 17,278,545 V167A probably damaging Het
Pgk2 A G 17: 40,207,509 F343L probably damaging Het
Piwil1 T C 5: 128,754,096 V827A probably damaging Het
Plag1 A T 4: 3,904,169 Y341N possibly damaging Het
Plch2 T C 4: 154,998,999 E393G probably damaging Het
Ptprg T A 14: 12,154,355 M692K probably benign Het
Rassf8 G A 6: 145,815,182 R78H probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,450,201 Q3556R probably damaging Het
Rpa2 T C 4: 132,768,788 probably null Het
Rpe T G 1: 66,715,980 F174V possibly damaging Het
Sbf2 T C 7: 110,560,295 D36G probably damaging Het
Scn2a T A 2: 65,752,079 Y1590* probably null Het
Slc24a4 T C 12: 102,222,759 V151A probably damaging Het
Slc30a8 A T 15: 52,295,934 M17L probably benign Het
Slit3 T C 11: 35,688,679 Y1228H probably damaging Het
Smad4 G A 18: 73,662,744 T193M probably benign Het
Smtn T A 11: 3,530,045 H392L probably benign Het
St8sia3 A G 18: 64,269,674 D128G probably damaging Het
Sucla2 A T 14: 73,592,668 M382L possibly damaging Het
Tbx5 A G 5: 119,836,923 T4A probably benign Het
Tdrd5 T C 1: 156,276,573 R528G probably damaging Het
Tex44 T C 1: 86,427,089 L240P probably benign Het
Tns4 A T 11: 99,080,078 probably null Het
Trappc10 A T 10: 78,203,924 V731E possibly damaging Het
Ttf1 A G 2: 29,071,345 K582E probably damaging Het
Ttf2 C A 3: 100,948,193 Q895H possibly damaging Het
Ttll6 A G 11: 96,147,532 E402G probably damaging Het
Ttn A T 2: 76,890,092 probably null Het
Ugt8a T C 3: 125,875,546 D303G probably damaging Het
Ulk1 G T 5: 110,792,436 A373D probably benign Het
Vmn2r13 A G 5: 109,158,192 S507P probably benign Het
Vmn2r19 T A 6: 123,316,074 D358E possibly damaging Het
Vmn2r88 T C 14: 51,413,807 S201P probably benign Het
Zfp36l2 A G 17: 84,186,975 F78S probably damaging Het
Zfp454 A C 11: 50,873,995 S203R probably benign Het
Zfp616 C A 11: 74,085,403 Q833K probably benign Het
Znhit2 A G 19: 6,062,061 T279A probably benign Het
Zswim3 T A 2: 164,819,993 I131N probably benign Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6016:Casz1 UTSW 4 148934584 missense probably damaging 1.00
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCTAGCTGAATGTTCCCGTTGAG -3'
(R):5'- TCTCTGCCAGGAGAAGCTTG -3'

Sequencing Primer
(F):5'- AATGTTCCCGTTGAGCAGGAG -3'
(R):5'- AGGAGAAGCTTGCCCTGG -3'
Posted On2014-09-17