Incidental Mutation 'R2082:Kcnu1'
ID230076
Institutional Source Beutler Lab
Gene Symbol Kcnu1
Ensembl Gene ENSMUSG00000031576
Gene Namepotassium channel, subfamily U, member 1
SynonymsKcnma3, Slo3
MMRRC Submission 040087-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2082 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location25849623-25937939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25921549 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 174 (L174H)
Ref Sequence ENSEMBL: ENSMUSP00000113442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098858] [ENSMUST00000120653] [ENSMUST00000126226]
Predicted Effect probably damaging
Transcript: ENSMUST00000098858
AA Change: L914H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096457
Gene: ENSMUSG00000031576
AA Change: L914H

DomainStartEndE-ValueType
transmembrane domain 27 49 N/A INTRINSIC
Pfam:Ion_trans 101 323 6.9e-21 PFAM
Pfam:Ion_trans_2 229 317 4.7e-12 PFAM
low complexity region 367 380 N/A INTRINSIC
Pfam:BK_channel_a 462 557 1.2e-28 PFAM
low complexity region 670 689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120653
AA Change: L174H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113442
Gene: ENSMUSG00000031576
AA Change: L174H

DomainStartEndE-ValueType
PDB:4HPF|B 1 332 1e-144 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000126226
SMART Domains Protein: ENSMUSP00000123273
Gene: ENSMUSG00000031576

DomainStartEndE-ValueType
PDB:4HPF|B 1 160 5e-61 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium channel family of proteins. The encoded voltage-gated ion channel allows the outward flow of potassium ions during plasma membrane hyperpolarization in sperm. Opening of this channel may be regulated by calcium ion levels. Homozygous knockout mice that lack the related mouse gene exhibit male sterility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous male mutants are infertile with impaired sperm capacitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T A 2: 30,796,379 probably null Het
4933427I04Rik A G 4: 123,860,976 I228V probably benign Het
Aco2 T C 15: 81,913,695 W657R possibly damaging Het
Acsm2 T A 7: 119,580,634 H333Q probably benign Het
Adamts18 C T 8: 113,775,333 V299I probably damaging Het
Adat2 G A 10: 13,560,163 C84Y probably damaging Het
Arhgef11 C T 3: 87,725,996 T690I possibly damaging Het
Cachd1 A G 4: 101,002,958 D1242G probably damaging Het
Casp14 A G 10: 78,715,033 M106T probably benign Het
Ccdc69 T A 11: 55,052,389 I130F probably damaging Het
Cdk9 A G 2: 32,709,501 L189P probably damaging Het
Cfhr1 C T 1: 139,550,886 V249I possibly damaging Het
Chst1 T C 2: 92,613,990 V269A possibly damaging Het
Col18a1 G T 10: 77,059,293 P1178Q probably damaging Het
Col6a1 A G 10: 76,709,596 L1014P probably damaging Het
Crisp3 T C 17: 40,225,860 Y188C probably damaging Het
Dse G A 10: 34,155,940 R363C probably damaging Het
Exoc5 T C 14: 49,015,587 I525V probably benign Het
Fech A T 18: 64,458,189 I388N probably damaging Het
Fmnl1 T C 11: 103,192,025 L363P probably damaging Het
Gm10842 T A 11: 105,147,083 L64Q unknown Het
Gm8225 C A 17: 26,543,696 P287Q possibly damaging Het
Hsp90aa1 A T 12: 110,692,827 L512H probably damaging Het
Ifi30 T C 8: 70,763,728 probably benign Het
Iqsec1 A T 6: 90,694,574 D115E probably damaging Het
Krt10 A G 11: 99,388,875 V153A probably damaging Het
Krt18 G A 15: 102,031,020 probably null Het
Micu1 A G 10: 59,863,307 T469A probably benign Het
Mtss1l T C 8: 110,726,257 probably null Het
Myo10 T A 15: 25,785,993 F1253L probably damaging Het
N4bp2 A T 5: 65,807,565 T986S probably damaging Het
Naip6 C A 13: 100,304,344 probably null Het
Nphp4 G A 4: 152,559,364 V1117M probably benign Het
Oca2 C A 7: 56,297,137 Q305K probably benign Het
Olfr195 T A 16: 59,148,885 F12I probably damaging Het
Olfr688 C T 7: 105,288,503 Q137* probably null Het
Olfr845 G A 9: 19,339,278 V273I probably benign Het
P2rx7 A T 5: 122,644,095 N8Y possibly damaging Het
Pag1 A T 3: 9,699,485 S203T probably damaging Het
Pfn4 T A 12: 4,775,439 probably null Het
Pip4k2c T C 10: 127,199,089 D414G probably damaging Het
Pkp1 T G 1: 135,884,976 Q329P possibly damaging Het
Polrmt A T 10: 79,743,512 I135N probably benign Het
Ppa2 G A 3: 133,370,417 R269H probably benign Het
Ppp3cb T C 14: 20,508,678 T439A possibly damaging Het
Prkdc A G 16: 15,715,963 Y1555C probably damaging Het
Ptprh T C 7: 4,550,775 D859G probably damaging Het
Sema5a T A 15: 32,618,856 M510K probably benign Het
Slc22a16 A G 10: 40,585,339 E379G probably benign Het
Slc30a5 C A 13: 100,806,533 probably null Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tbc1d9 A T 8: 83,270,987 S1058C probably damaging Het
Tet2 A G 3: 133,485,727 L982P possibly damaging Het
Tmem101 G T 11: 102,153,377 T228K probably benign Het
Tshz2 G T 2: 169,886,215 K441N probably damaging Het
Upf1 A T 8: 70,341,572 I228N probably damaging Het
Usp32 A T 11: 85,030,512 I692N probably damaging Het
Vmn2r117 A G 17: 23,460,256 S665P possibly damaging Het
Vps13b T C 15: 35,910,746 V3552A possibly damaging Het
Vps35 A T 8: 85,263,465 M638K possibly damaging Het
Vps41 T G 13: 18,852,351 I645S probably benign Het
Zfp703 T C 8: 26,978,988 S227P probably benign Het
Other mutations in Kcnu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Kcnu1 APN 8 25897856 missense probably benign 0.00
IGL00580:Kcnu1 APN 8 25865663 missense probably benign 0.04
IGL00675:Kcnu1 APN 8 25851849 missense probably benign
IGL00928:Kcnu1 APN 8 25849735 missense probably damaging 1.00
IGL01324:Kcnu1 APN 8 25849707 missense probably benign 0.22
IGL01346:Kcnu1 APN 8 25934523 splice site probably benign
IGL01361:Kcnu1 APN 8 25886768 missense possibly damaging 0.78
IGL01651:Kcnu1 APN 8 25861095 missense probably damaging 1.00
IGL01795:Kcnu1 APN 8 25913705 missense probably damaging 1.00
IGL01800:Kcnu1 APN 8 25937500 missense probably damaging 1.00
IGL01975:Kcnu1 APN 8 25934497 missense probably benign 0.29
IGL02103:Kcnu1 APN 8 25905948 missense possibly damaging 0.83
IGL02109:Kcnu1 APN 8 25937699 missense possibly damaging 0.66
IGL02127:Kcnu1 APN 8 25892062 missense probably damaging 1.00
IGL02170:Kcnu1 APN 8 25937560 missense probably damaging 1.00
IGL02217:Kcnu1 APN 8 25858184 missense probably damaging 1.00
IGL02385:Kcnu1 APN 8 25932270 missense probably damaging 1.00
IGL02493:Kcnu1 APN 8 25937520 missense possibly damaging 0.68
IGL02883:Kcnu1 APN 8 25849827 missense probably benign
IGL02884:Kcnu1 APN 8 25921528 missense probably damaging 1.00
IGL03022:Kcnu1 APN 8 25937586 missense probably damaging 0.98
IGL03281:Kcnu1 APN 8 25892077 missense probably null 1.00
IGL03345:Kcnu1 APN 8 25881293 splice site probably benign
P0026:Kcnu1 UTSW 8 25892122 missense probably damaging 1.00
PIT4677001:Kcnu1 UTSW 8 25905993 missense probably benign
R0001:Kcnu1 UTSW 8 25859270 missense probably damaging 1.00
R0419:Kcnu1 UTSW 8 25937618 missense probably benign 0.13
R0518:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0521:Kcnu1 UTSW 8 25910888 missense probably damaging 1.00
R0581:Kcnu1 UTSW 8 25937501 missense probably damaging 1.00
R0840:Kcnu1 UTSW 8 25913684 start codon destroyed probably null 1.00
R1282:Kcnu1 UTSW 8 25905957 missense probably benign 0.02
R1556:Kcnu1 UTSW 8 25861191 critical splice donor site probably null
R1600:Kcnu1 UTSW 8 25849793 missense probably damaging 1.00
R2011:Kcnu1 UTSW 8 25918442 missense probably benign 0.03
R2035:Kcnu1 UTSW 8 25896693 missense probably benign 0.35
R2132:Kcnu1 UTSW 8 25851900 missense probably damaging 0.99
R2415:Kcnu1 UTSW 8 25910878 missense probably benign
R2513:Kcnu1 UTSW 8 25905966 missense probably benign 0.00
R3712:Kcnu1 UTSW 8 25881420 missense probably damaging 1.00
R3749:Kcnu1 UTSW 8 25886770 missense probably null 0.01
R3840:Kcnu1 UTSW 8 25885352 missense possibly damaging 0.95
R3874:Kcnu1 UTSW 8 25885317 missense probably damaging 1.00
R4184:Kcnu1 UTSW 8 25862417 missense probably damaging 1.00
R4576:Kcnu1 UTSW 8 25890020 missense probably benign 0.06
R4658:Kcnu1 UTSW 8 25937555 missense probably damaging 1.00
R4667:Kcnu1 UTSW 8 25910921 missense possibly damaging 0.69
R4791:Kcnu1 UTSW 8 25913752 missense probably damaging 1.00
R4940:Kcnu1 UTSW 8 25897862 splice site probably null
R5120:Kcnu1 UTSW 8 25934488 missense possibly damaging 0.79
R5314:Kcnu1 UTSW 8 25862458 missense probably damaging 0.97
R5712:Kcnu1 UTSW 8 25919650 missense probably damaging 1.00
R5807:Kcnu1 UTSW 8 25849714 missense possibly damaging 0.78
R6237:Kcnu1 UTSW 8 25932334 missense probably benign
R6260:Kcnu1 UTSW 8 25851891 missense probably damaging 1.00
R6360:Kcnu1 UTSW 8 25861180 missense possibly damaging 0.73
R6612:Kcnu1 UTSW 8 25918316 missense probably benign 0.10
R6708:Kcnu1 UTSW 8 25937711 missense probably benign
R6765:Kcnu1 UTSW 8 25913645 missense probably damaging 1.00
R6816:Kcnu1 UTSW 8 25937734 nonsense probably null
R7030:Kcnu1 UTSW 8 25918463 missense probably benign 0.00
R7202:Kcnu1 UTSW 8 25919581 splice site probably null
R7208:Kcnu1 UTSW 8 25919637 nonsense probably null
R7411:Kcnu1 UTSW 8 25892088 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGAGCTTTTGTCTGCCAC -3'
(R):5'- CCAGGACTGTCGTCTTGAAAATG -3'

Sequencing Primer
(F):5'- TTGTCTGCCACAAAGGACTG -3'
(R):5'- CTGTCGTCTTGAAAATGTGAAAACC -3'
Posted On2014-09-18