Incidental Mutation 'R2085:Mbd4'
ID230256
Institutional Source Beutler Lab
Gene Symbol Mbd4
Ensembl Gene ENSMUSG00000030322
Gene Namemethyl-CpG binding domain protein 4
SynonymsMed1
MMRRC Submission 040090-MU
Accession Numbers

Ncbi RefSeq: NM_010774.2; MGI:1333850

Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R2085 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115840697-115853371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115848957 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 358 (M358L)
Ref Sequence ENSEMBL: ENSMUSP00000032469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032469] [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000122816] [ENSMUST00000141305] [ENSMUST00000147282] [ENSMUST00000203643]
Predicted Effect probably benign
Transcript: ENSMUST00000032469
AA Change: M358L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000032469
Gene: ENSMUSG00000030322
AA Change: M358L

DomainStartEndE-ValueType
MBD 66 142 1.25e-29 SMART
low complexity region 178 196 N/A INTRINSIC
PDB:1NGN|A 400 554 1e-111 PDB
SCOP:d1keaa_ 405 545 1e-23 SMART
Blast:ENDO3c 439 514 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038234
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112923
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122816
AA Change: M358L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000145433
Gene: ENSMUSG00000030322
AA Change: M358L

DomainStartEndE-ValueType
MBD 66 142 7.6e-32 SMART
low complexity region 178 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133830
Predicted Effect probably benign
Transcript: ENSMUST00000141305
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147282
AA Change: M337L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125619
Gene: ENSMUSG00000030322
AA Change: M337L

DomainStartEndE-ValueType
MBD 45 121 1.25e-29 SMART
low complexity region 157 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203243
Predicted Effect probably benign
Transcript: ENSMUST00000203643
AA Change: M4L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144930
Gene: ENSMUSG00000030322
AA Change: M4L

DomainStartEndE-ValueType
Pfam:HhH-GPD 56 168 2.7e-5 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype Strain: 2447611
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of nuclear proteins related by the presence of a methyl-CpG binding domain (MBD). These proteins are capable of binding specifically to methylated DNA, and some members can also repress transcription from methylated gene promoters. This protein contains an MBD domain at the N-terminus that functions both in binding to methylated DNA and in protein interactions and a C-terminal mismatch-specific glycosylase domain that is involved in DNA repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele have an increased rate of DNA mutation, specifically at CpGs. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted(6) Gene trapped(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Cgnl1 G A 9: 71,630,878 T1194M probably damaging Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
Efhb C T 17: 53,426,909 probably null Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr905 A G 9: 38,472,927 Y60C probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Prickle2 T C 6: 92,376,364 E763G probably damaging Het
Rdh11 T C 12: 79,182,782 Y239C possibly damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Wdr46 G T 17: 33,941,451 E135* probably null Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Mbd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Mbd4 APN 6 115849530 missense probably damaging 0.99
IGL01545:Mbd4 APN 6 115850797 missense probably damaging 1.00
IGL01657:Mbd4 APN 6 115849637 missense probably damaging 0.99
IGL02406:Mbd4 APN 6 115849025 missense possibly damaging 0.96
E0370:Mbd4 UTSW 6 115849155 missense possibly damaging 0.91
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0025:Mbd4 UTSW 6 115844568 critical splice donor site probably null
R0538:Mbd4 UTSW 6 115849482 missense probably damaging 0.99
R4405:Mbd4 UTSW 6 115849115 missense possibly damaging 0.92
R4464:Mbd4 UTSW 6 115849502 missense probably damaging 0.99
R4780:Mbd4 UTSW 6 115849384 missense probably benign
R4782:Mbd4 UTSW 6 115845322 missense possibly damaging 0.49
R4799:Mbd4 UTSW 6 115845322 missense probably benign 0.26
R4814:Mbd4 UTSW 6 115849299 missense possibly damaging 0.85
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4860:Mbd4 UTSW 6 115848926 missense possibly damaging 0.51
R4976:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
R5126:Mbd4 UTSW 6 115848968 unclassified probably null
R5202:Mbd4 UTSW 6 115849402 missense probably damaging 0.96
R5485:Mbd4 UTSW 6 115850718 missense probably benign 0.21
R6179:Mbd4 UTSW 6 115845425 missense probably benign 0.00
R6661:Mbd4 UTSW 6 115849155 nonsense probably null
R7008:Mbd4 UTSW 6 115850724 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGAGAATATATCTGACGCTTGACTC -3'
(R):5'- CTGTGCAAGGGAGACTGTTG -3'

Sequencing Primer
(F):5'- GACGCTTGACTCTTCTTCACTATAC -3'
(R):5'- CAGGACTGGATCTTTGTTTCATAC -3'
Posted On2014-09-18