Incidental Mutation 'R2085:Rdh11'
ID230281
Institutional Source Beutler Lab
Gene Symbol Rdh11
Ensembl Gene ENSMUSG00000066441
Gene Nameretinol dehydrogenase 11
SynonymsArsdr1, Mdt1, Psdr1, 2610319N22Rik, M42C60
MMRRC Submission 040090-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R2085 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location79174337-79192293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79182782 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 239 (Y239C)
Ref Sequence ENSEMBL: ENSMUSP00000124066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085254] [ENSMUST00000159500] [ENSMUST00000161204]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085254
AA Change: Y223C

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082352
Gene: ENSMUSG00000066441
AA Change: Y223C

DomainStartEndE-ValueType
Pfam:adh_short 23 201 1.3e-23 PFAM
Pfam:KR 24 190 1.6e-10 PFAM
Pfam:Epimerase 25 227 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159500
Predicted Effect possibly damaging
Transcript: ENSMUST00000161204
AA Change: Y239C

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124066
Gene: ENSMUSG00000066441
AA Change: Y239C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:adh_short 39 244 1.7e-36 PFAM
Pfam:KR 40 199 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an NADPH-dependent retinal reductase and a short-chain dehydrogenase/reductase. The encoded protein has no steroid dehydrogenase activity. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit delayed dark adaptation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik G T 11: 69,900,372 T127K possibly damaging Het
A2m T G 6: 121,676,959 I1417S probably damaging Het
Acad10 A G 5: 121,649,460 I142T possibly damaging Het
Adprm T A 11: 67,041,852 D77V probably damaging Het
Apob C T 12: 8,012,240 T3574I probably damaging Het
Bahcc1 A G 11: 120,288,082 K2489R probably damaging Het
Bub1b A G 2: 118,622,195 E443G possibly damaging Het
Cd9 A T 6: 125,463,771 probably null Het
Cgnl1 G A 9: 71,630,878 T1194M probably damaging Het
Clec9a T C 6: 129,410,311 V43A probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Dpep3 A G 8: 105,974,714 V401A probably damaging Het
Duox2 G T 2: 122,280,967 H1417N probably damaging Het
Efhb C T 17: 53,426,909 probably null Het
F2r T C 13: 95,604,910 N39S probably benign Het
Fcamr T C 1: 130,811,598 F212L probably damaging Het
Galt G A 4: 41,758,162 R309Q probably damaging Het
Gas2l2 C A 11: 83,427,383 A167S probably benign Het
Hecw1 A T 13: 14,264,087 F904I possibly damaging Het
Herc2 C A 7: 56,212,965 H4127Q possibly damaging Het
Hipk1 T C 3: 103,750,354 T805A probably benign Het
Hivep1 A G 13: 42,183,750 E2435G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hivep2 C A 10: 14,139,529 C1813* probably null Het
Hyal4 C T 6: 24,755,750 probably benign Het
Inpp4b A G 8: 81,952,274 Y311C probably damaging Het
Itih4 A G 14: 30,892,323 Y410C possibly damaging Het
Lama2 A T 10: 27,204,841 C995* probably null Het
Lingo4 C A 3: 94,402,245 D163E probably damaging Het
Malt1 A G 18: 65,473,147 D642G probably damaging Het
Mbd4 T A 6: 115,848,957 M358L probably benign Het
Mbd5 T A 2: 49,279,311 F1498Y possibly damaging Het
Me1 T C 9: 86,613,554 Q280R probably damaging Het
Megf9 T C 4: 70,448,767 H326R probably damaging Het
Nid2 G A 14: 19,778,043 G516S probably benign Het
Olfr186 C T 16: 59,027,869 V13I probably benign Het
Olfr20 T C 11: 73,354,421 S223P possibly damaging Het
Olfr62 T C 4: 118,666,104 S196P probably damaging Het
Olfr728 T A 14: 50,140,123 N172I probably damaging Het
Olfr905 A G 9: 38,472,927 Y60C probably damaging Het
Polr2j T C 5: 136,116,771 F7L probably damaging Het
Ppp1r16a T A 15: 76,693,596 D303E probably damaging Het
Prickle2 T C 6: 92,376,364 E763G probably damaging Het
Sdhaf3 A G 6: 6,956,048 R8G probably benign Het
Sgk2 T C 2: 163,012,970 S305P probably damaging Het
Sptbn2 A G 19: 4,738,559 S1189G probably benign Het
Stab2 A G 10: 86,954,159 L581P probably damaging Het
Tifab T C 13: 56,176,297 Q111R probably damaging Het
Ubr3 C T 2: 69,953,764 R775C probably damaging Het
Usp17lb T A 7: 104,840,415 Q434L possibly damaging Het
Wdr46 G T 17: 33,941,451 E135* probably null Het
Zfp318 T A 17: 46,409,664 probably null Het
Zfp874a T A 13: 67,442,848 H239L probably damaging Het
Zscan29 A T 2: 121,169,946 L60* probably null Het
Other mutations in Rdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Rdh11 APN 12 79186413 critical splice donor site probably null
IGL02642:Rdh11 APN 12 79185336 splice site probably benign
IGL02867:Rdh11 APN 12 79189054 missense possibly damaging 0.64
R2115:Rdh11 UTSW 12 79176222 missense probably benign
R4963:Rdh11 UTSW 12 79188606 missense probably benign 0.31
R5458:Rdh11 UTSW 12 79188505 missense probably benign 0.11
R6090:Rdh11 UTSW 12 79189064 missense probably benign 0.05
R6519:Rdh11 UTSW 12 79182815 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTTATTTCCCCAAAGCAG -3'
(R):5'- TTAGGAGCCTGCTTCCTGAG -3'

Sequencing Primer
(F):5'- GTTATTTCCCCAAAGCAGTAACAAC -3'
(R):5'- TGTGACATAGATGCTCACCAG -3'
Posted On2014-09-18