Incidental Mutation 'R2102:Rpl7a'
ID230546
Institutional Source Beutler Lab
Gene Symbol Rpl7a
Ensembl Gene ENSMUSG00000062647
Gene Nameribosomal protein L7A
Synonymssurfeit 3, Surf-3
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R2102 (G1)
Quality Score116
Status Not validated
Chromosome2
Chromosomal Location26910764-26913318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 26911461 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 55 (V55G)
Ref Sequence ENSEMBL: ENSMUSP00000099962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015017] [ENSMUST00000015920] [ENSMUST00000015934] [ENSMUST00000102898] [ENSMUST00000102899] [ENSMUST00000129682] [ENSMUST00000133513] [ENSMUST00000139815] [ENSMUST00000147110] [ENSMUST00000167661]
Predicted Effect probably benign
Transcript: ENSMUST00000015017
SMART Domains Protein: ENSMUSP00000015017
Gene: ENSMUSG00000014873

DomainStartEndE-ValueType
Pfam:SURF2 4 251 5.7e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000015920
SMART Domains Protein: ENSMUSP00000015920
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 20 125 5.7e-40 PFAM
low complexity region 127 141 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000015934
SMART Domains Protein: ENSMUSP00000015934
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
Pfam:SURF1 106 321 6.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083361
Predicted Effect possibly damaging
Transcript: ENSMUST00000102898
AA Change: V55G

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099962
Gene: ENSMUSG00000062647
AA Change: V55G

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 122 216 1.2e-25 PFAM
low complexity region 251 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102899
SMART Domains Protein: ENSMUSP00000099963
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 14 130 5.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129673
Predicted Effect probably benign
Transcript: ENSMUST00000129682
Predicted Effect probably benign
Transcript: ENSMUST00000129822
Predicted Effect probably benign
Transcript: ENSMUST00000133513
SMART Domains Protein: ENSMUSP00000141317
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 63 7.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136269
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137376
Predicted Effect probably benign
Transcript: ENSMUST00000139815
SMART Domains Protein: ENSMUSP00000116442
Gene: ENSMUSG00000015776

DomainStartEndE-ValueType
Pfam:Med22 14 72 3e-14 PFAM
Pfam:Med22 96 166 2.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143678
Predicted Effect probably benign
Transcript: ENSMUST00000147110
SMART Domains Protein: ENSMUSP00000141238
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
Pfam:SURF1 30 240 5.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147143
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150776
Predicted Effect probably benign
Transcript: ENSMUST00000167661
SMART Domains Protein: ENSMUSP00000128488
Gene: ENSMUSG00000015790

DomainStartEndE-ValueType
low complexity region 51 66 N/A INTRINSIC
Pfam:SURF1 73 290 5.9e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183520
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Rpl7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Rpl7a APN 2 26911055 unclassified probably benign
IGL00951:Rpl7a APN 2 26912429 missense possibly damaging 0.47
R0041:Rpl7a UTSW 2 26911551 unclassified probably null
R1491:Rpl7a UTSW 2 26911115 missense probably damaging 0.98
R6601:Rpl7a UTSW 2 26911524 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TCGTGTGCAGATGATGTGAC -3'
(R):5'- CTTCATAGCTGTATTAGTGTGGCC -3'

Sequencing Primer
(F):5'- GCAGATGATGTGACAGAATATTTGC -3'
(R):5'- TGGCCATGCACTGCAGTAAG -3'
Posted On2014-09-18