Incidental Mutation 'R2102:Plekha5'
ID230571
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140572877 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 297 (A297T)
Ref Sequence ENSEMBL: ENSMUSP00000144973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203012] [ENSMUST00000203483] [ENSMUST00000203517] [ENSMUST00000204080] [ENSMUST00000204145] [ENSMUST00000205026] [ENSMUST00000213444]
Predicted Effect probably damaging
Transcript: ENSMUST00000087622
AA Change: A821T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: A821T

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203012
AA Change: A342T

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145499
Gene: ENSMUSG00000030231
AA Change: A342T

DomainStartEndE-ValueType
Blast:PH 210 250 2e-8 BLAST
coiled coil region 268 302 N/A INTRINSIC
low complexity region 417 437 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 727 745 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203315
Predicted Effect probably benign
Transcript: ENSMUST00000203483
SMART Domains Protein: ENSMUSP00000145219
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
low complexity region 261 279 N/A INTRINSIC
low complexity region 298 313 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203517
AA Change: A776T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: A776T

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000203955
AA Change: A668T
Predicted Effect possibly damaging
Transcript: ENSMUST00000204080
AA Change: A352T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144872
Gene: ENSMUSG00000030231
AA Change: A352T

DomainStartEndE-ValueType
Blast:PH 220 260 1e-8 BLAST
coiled coil region 278 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204145
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204755
Predicted Effect probably damaging
Transcript: ENSMUST00000205026
AA Change: A297T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144973
Gene: ENSMUSG00000030231
AA Change: A297T

DomainStartEndE-ValueType
Blast:PH 165 205 1e-8 BLAST
coiled coil region 223 257 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205255
Predicted Effect probably damaging
Transcript: ENSMUST00000213444
AA Change: A148T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6501:Plekha5 UTSW 6 140525929 nonsense probably null
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAATCTTCAGCACTGCCAAAG -3'
(R):5'- TCACTGAAGACACTCCACTGTG -3'

Sequencing Primer
(F):5'- CTCTGGAAGAACAGTCAGTGCTC -3'
(R):5'- TGTATCCGCAGAGGCCAACAG -3'
Posted On2014-09-18