Incidental Mutation 'R2102:Tph1'
ID230574
Institutional Source Beutler Lab
Gene Symbol Tph1
Ensembl Gene ENSMUSG00000040046
Gene Nametryptophan hydroxylase 1
Synonyms
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46644641-46672537 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 46660410 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049298] [ENSMUST00000107669] [ENSMUST00000168335] [ENSMUST00000170251]
Predicted Effect probably null
Transcript: ENSMUST00000049298
SMART Domains Protein: ENSMUSP00000037752
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 4.3e-8 PFAM
Pfam:Biopterin_H 109 440 4.7e-188 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107669
SMART Domains Protein: ENSMUSP00000103296
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:Biopterin_H 109 439 7.6e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163468
Predicted Effect probably damaging
Transcript: ENSMUST00000168335
AA Change: N139K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128107
Gene: ENSMUSG00000040046
AA Change: N139K

DomainStartEndE-ValueType
Pfam:ACT 21 87 3.7e-9 PFAM
Pfam:Biopterin_H 109 149 1.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170045
Predicted Effect probably benign
Transcript: ENSMUST00000170251
SMART Domains Protein: ENSMUSP00000132489
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 6.7e-8 PFAM
Pfam:Biopterin_H 109 279 3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172386
SMART Domains Protein: ENSMUSP00000128727
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 17 82 6.9e-9 PFAM
Pfam:Biopterin_H 105 164 8.9e-24 PFAM
low complexity region 175 188 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one null allele display no gross behavioral abnormalities. Mice homozygous for a second null allele display fatigue, breathing difficulties, progressive pallor, and impaired cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Tph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Tph1 APN 7 46656870 missense probably benign 0.02
IGL01318:Tph1 APN 7 46665238 missense probably damaging 0.99
IGL01538:Tph1 APN 7 46653753 missense probably damaging 1.00
IGL01564:Tph1 APN 7 46650881 splice site probably benign
IGL02021:Tph1 APN 7 46656997 missense possibly damaging 0.55
IGL02202:Tph1 APN 7 46653761 missense probably benign 0.40
IGL03072:Tph1 APN 7 46652859 missense probably damaging 0.99
I1329:Tph1 UTSW 7 46650013 missense probably damaging 0.99
R0166:Tph1 UTSW 7 46647596 missense probably damaging 1.00
R0433:Tph1 UTSW 7 46653821 missense probably damaging 1.00
R0485:Tph1 UTSW 7 46650024 missense probably benign 0.00
R0501:Tph1 UTSW 7 46649988 nonsense probably null
R1456:Tph1 UTSW 7 46647483 nonsense probably null
R1474:Tph1 UTSW 7 46653862 missense probably benign 0.00
R1846:Tph1 UTSW 7 46660439 missense probably damaging 0.98
R1967:Tph1 UTSW 7 46662114 missense probably benign 0.30
R2176:Tph1 UTSW 7 46662039 missense possibly damaging 0.91
R2225:Tph1 UTSW 7 46665174 critical splice donor site probably null
R4773:Tph1 UTSW 7 46656952 missense probably damaging 1.00
R4914:Tph1 UTSW 7 46653859 missense probably damaging 1.00
R5590:Tph1 UTSW 7 46653792 missense probably damaging 1.00
R5622:Tph1 UTSW 7 46647545 nonsense probably null
R5960:Tph1 UTSW 7 46662005 critical splice donor site probably null
R5985:Tph1 UTSW 7 46653781 missense probably damaging 1.00
R6362:Tph1 UTSW 7 46647443 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAGCGCTTTGTATAATTGCCTAG -3'
(R):5'- TCAAACTGCTCTTGCTTCTGAG -3'

Sequencing Primer
(F):5'- AGGATCTAGGGTTCAGTTCCCAAC -3'
(R):5'- AGTTTTTGCTTCGGTTAAGACAGTC -3'
Posted On2014-09-18