Incidental Mutation 'R2102:Plxnb1'
ID230590
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109115742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 2051 (M2051K)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: M2051K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: M2051K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TATGCTCGAGATATTCCCCGTTAC -3'
(R):5'- AGACCCCATTAGGTGACAGC -3'

Sequencing Primer
(F):5'- TTCCCCGTTACAAACAGATGGTG -3'
(R):5'- CCCATTAGGTGACAGCTATCAGATG -3'
Posted On2014-09-18