Incidental Mutation 'R2102:Abca8a'
ID230600
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 040106-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 110068052 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 749 (P749T)
Ref Sequence ENSEMBL: ENSMUSP00000102275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect probably damaging
Transcript: ENSMUST00000046223
AA Change: P748T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: P748T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100287
AA Change: P749T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: P749T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106664
AA Change: P749T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: P749T

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129810
Predicted Effect probably benign
Transcript: ENSMUST00000146635
SMART Domains Protein: ENSMUSP00000114393
Gene: ENSMUSG00000041828

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ABC_tran 114 210 4.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154849
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 intron probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4571:Abca8a UTSW 11 110030058 missense probably damaging 1.00
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTCTGAGGTGTGACACTC -3'
(R):5'- ATAGATGCTCTTCCCTGGTTG -3'

Sequencing Primer
(F):5'- ATGCACAGCAATCTGGC -3'
(R):5'- AGATGCTCTTCCCTGGTTGTTTTTG -3'
Posted On2014-09-18