Incidental Mutation 'R2102:Ednrb'
ID230619
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Nameendothelin receptor type B
SynonymsETb, ETR-b, Sox10m1
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location103814625-103844402 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 103820914 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 318 (R318*)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
Predicted Effect probably null
Transcript: ENSMUST00000022718
AA Change: R318*
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: R318*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172237
AA Change: R318*
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: R318*

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227824
AA Change: R318*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 103820019 missense probably damaging 1.00
IGL01433:Ednrb APN 14 103843190 missense probably damaging 0.98
IGL01631:Ednrb APN 14 103843225 missense probably benign 0.02
IGL01696:Ednrb APN 14 103823189 missense probably benign 0.00
IGL01974:Ednrb APN 14 103820818 missense probably damaging 1.00
IGL02749:Ednrb APN 14 103823059 missense possibly damaging 0.63
IGL03277:Ednrb APN 14 103843299 missense probably benign 0.00
gus-gus UTSW 14 103820013 missense probably damaging 1.00
pongo UTSW 14 103823274 splice site probably null
sposh UTSW 14 103821714 missense probably damaging 0.97
R0284:Ednrb UTSW 14 103820013 missense probably damaging 1.00
R0591:Ednrb UTSW 14 103823274 splice site probably null
R2072:Ednrb UTSW 14 103817099 missense probably benign 0.27
R2080:Ednrb UTSW 14 103843100 missense probably damaging 1.00
R2118:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2119:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2124:Ednrb UTSW 14 103821768 missense probably benign 0.42
R2851:Ednrb UTSW 14 103821674 missense probably benign 0.04
R2852:Ednrb UTSW 14 103821674 missense probably benign 0.04
R3708:Ednrb UTSW 14 103817080 missense probably damaging 1.00
R4887:Ednrb UTSW 14 103820011 missense possibly damaging 0.95
R5626:Ednrb UTSW 14 103843128 missense probably damaging 0.98
R5688:Ednrb UTSW 14 103823395 missense probably damaging 1.00
R5802:Ednrb UTSW 14 103821714 missense probably damaging 0.97
R5834:Ednrb UTSW 14 103820877 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCTGGATGACAATTCC -3'
(R):5'- GAACATGAGCCACTGTGGAG -3'

Sequencing Primer
(F):5'- CTCTTTCAATCTAAGTTAGCACAGG -3'
(R):5'- CCACTGTGGAGGTACTTGTACTAGC -3'
Posted On2014-09-18