Incidental Mutation 'R2102:Lifr'
ID230620
Institutional Source Beutler Lab
Gene Symbol Lifr
Ensembl Gene ENSMUSG00000054263
Gene Nameleukemia inhibitory factor receptor
SynonymsA230075M04Rik, soluble differentiation-stimulating factor receptor
MMRRC Submission 040106-MU
Accession Numbers

Genbank: NM_013584; MGI: 96788  

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7090614-7197489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7186923 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 793 (I793T)
Ref Sequence ENSEMBL: ENSMUSP00000154750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067190] [ENSMUST00000164529] [ENSMUST00000171588] [ENSMUST00000226471] [ENSMUST00000226934] [ENSMUST00000227727]
Predicted Effect probably damaging
Transcript: ENSMUST00000067190
AA Change: I793T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064551
Gene: ENSMUSG00000054263
AA Change: I793T

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164529
SMART Domains Protein: ENSMUSP00000131434
Gene: ENSMUSG00000054263

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 4e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171588
AA Change: I793T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126137
Gene: ENSMUSG00000054263
AA Change: I793T

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Blast:FN3 45 118 5e-22 BLAST
FN3 328 399 1.86e1 SMART
FN3 425 515 9.77e-5 SMART
FN3 530 611 2.68e0 SMART
FN3 620 705 8.23e1 SMART
FN3 719 815 4.81e-4 SMART
transmembrane domain 830 852 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226471
AA Change: I793T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000226934
Predicted Effect probably benign
Transcript: ENSMUST00000227727
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the type I cytokine receptor family. This protein combines with a high-affinity converter subunit, gp130, to form a receptor complex that mediates the action of the leukemia inhibitory factor, a polyfunctional cytokine that is involved in cellular differentiation, proliferation and survival in the adult and the embryo. Mutations in this gene cause Schwartz-Jampel syndrome type 2, a disease belonging to the group of the bent-bone dysplasias. A translocation that involves the promoter of this gene, t(5;8)(p13;q12) with the pleiomorphic adenoma gene 1, is associated with salivary gland pleiomorphic adenoma, a common type of benign epithelial tumor of the salivary gland. Multiple splice variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die as neonates with reduced numbers of facial and spinal motor neurons, neurons of the nucleus ambiguus, and astrocytes. Mutants also show impaired placentation, severe osteopenia, and low hepatic glycogen stores. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(19)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Lifr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Lifr APN 15 7185739 splice site probably null
IGL01470:Lifr APN 15 7175666 nonsense probably null
IGL01489:Lifr APN 15 7175556 splice site probably benign
IGL01619:Lifr APN 15 7191162 missense probably damaging 1.00
IGL01636:Lifr APN 15 7179018 splice site probably benign
IGL01943:Lifr APN 15 7188149 missense probably damaging 1.00
IGL02253:Lifr APN 15 7190604 missense probably damaging 1.00
IGL02355:Lifr APN 15 7164693 critical splice donor site probably null
IGL02362:Lifr APN 15 7164693 critical splice donor site probably null
IGL02450:Lifr APN 15 7190765 missense probably damaging 1.00
IGL02477:Lifr APN 15 7186923 missense probably damaging 1.00
IGL02503:Lifr APN 15 7185623 missense probably damaging 1.00
IGL02571:Lifr APN 15 7190111 unclassified probably benign
IGL03340:Lifr APN 15 7177936 missense probably benign 0.02
N/A - 535:Lifr UTSW 15 7186953 missense possibly damaging 0.80
R0012:Lifr UTSW 15 7175608 missense possibly damaging 0.78
R0015:Lifr UTSW 15 7188186 unclassified probably null
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0102:Lifr UTSW 15 7178892 missense probably damaging 0.98
R0305:Lifr UTSW 15 7177501 missense probably damaging 0.99
R0416:Lifr UTSW 15 7166914 missense probably damaging 1.00
R0440:Lifr UTSW 15 7157191 nonsense probably null
R0519:Lifr UTSW 15 7177580 missense probably damaging 1.00
R0595:Lifr UTSW 15 7177469 missense probably damaging 1.00
R0601:Lifr UTSW 15 7169272 splice site probably null
R0780:Lifr UTSW 15 7177466 missense probably benign 0.00
R0790:Lifr UTSW 15 7185715 missense probably benign 0.13
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1376:Lifr UTSW 15 7184764 missense probably benign 0.04
R1400:Lifr UTSW 15 7190865 missense probably benign 0.04
R1498:Lifr UTSW 15 7190618 missense probably damaging 0.99
R1785:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1786:Lifr UTSW 15 7181856 missense possibly damaging 0.89
R1906:Lifr UTSW 15 7188131 missense probably damaging 0.98
R2099:Lifr UTSW 15 7157251 missense probably benign
R2136:Lifr UTSW 15 7181857 missense possibly damaging 0.89
R2511:Lifr UTSW 15 7166916 missense probably benign
R4375:Lifr UTSW 15 7166898 missense probably benign
R4883:Lifr UTSW 15 7185625 missense possibly damaging 0.94
R5681:Lifr UTSW 15 7191084 missense probably damaging 1.00
R5689:Lifr UTSW 15 7184804 missense probably damaging 1.00
R5693:Lifr UTSW 15 7175560 missense probably damaging 1.00
R5902:Lifr UTSW 15 7190750 missense probably benign
R5918:Lifr UTSW 15 7159416 missense probably benign 0.00
R5924:Lifr UTSW 15 7172972 missense probably benign 0.28
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6037:Lifr UTSW 15 7186943 missense probably damaging 1.00
R6289:Lifr UTSW 15 7166910 missense probably benign 0.00
R6339:Lifr UTSW 15 7167049 missense probably benign 0.01
R6860:Lifr UTSW 15 7172937 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCCCTACAGAGTCAGAGAAG -3'
(R):5'- TGTCCCCAGATGCTAAGGACAC -3'

Sequencing Primer
(F):5'- GAAGAACTTGAATGTGGCCCC -3'
(R):5'- TAAGGACACTATCGCTCCAGTGG -3'
Posted On2014-09-18