Incidental Mutation 'R2102:Ppp6r2'
ID230623
Institutional Source Beutler Lab
Gene Symbol Ppp6r2
Ensembl Gene ENSMUSG00000036561
Gene Nameprotein phosphatase 6, regulatory subunit 2
SynonymsPp6r2, Saps2, 1110033O10Rik, 8430411H09Rik, B230107H12Rik
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R2102 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89211553-89287010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89278746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 524 (T524A)
Ref Sequence ENSEMBL: ENSMUSP00000154087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088788] [ENSMUST00000228284]
Predicted Effect probably damaging
Transcript: ENSMUST00000088788
AA Change: T524A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086167
Gene: ENSMUSG00000036561
AA Change: T524A

DomainStartEndE-ValueType
Pfam:SAPS 128 365 1.7e-73 PFAM
Pfam:SAPS 361 534 2.4e-47 PFAM
low complexity region 606 618 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 867 900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226967
Predicted Effect probably damaging
Transcript: ENSMUST00000228284
AA Change: T524A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Gpr82 T C X: 13,666,035 V274A probably benign Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Ppp6r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ppp6r2 APN 15 89285813 missense probably benign 0.44
IGL00480:Ppp6r2 APN 15 89265249 splice site probably benign
IGL01061:Ppp6r2 APN 15 89286015 splice site probably benign
IGL01116:Ppp6r2 APN 15 89281989 missense probably damaging 1.00
IGL01317:Ppp6r2 APN 15 89285928 missense possibly damaging 0.62
IGL01947:Ppp6r2 APN 15 89278726 missense probably damaging 1.00
IGL01969:Ppp6r2 APN 15 89275510 missense probably damaging 0.99
IGL01999:Ppp6r2 APN 15 89269952 missense probably benign 0.09
IGL02634:Ppp6r2 APN 15 89275477 nonsense probably null
IGL02697:Ppp6r2 APN 15 89256755 missense probably benign 0.38
IGL02964:Ppp6r2 APN 15 89259175 missense probably damaging 1.00
IGL03107:Ppp6r2 APN 15 89268545 missense probably damaging 0.98
IGL03195:Ppp6r2 APN 15 89268555 missense possibly damaging 0.50
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0183:Ppp6r2 UTSW 15 89285787 missense probably damaging 0.99
R0745:Ppp6r2 UTSW 15 89265242 critical splice donor site probably null
R0835:Ppp6r2 UTSW 15 89268582 missense possibly damaging 0.90
R0959:Ppp6r2 UTSW 15 89274176 missense possibly damaging 0.81
R1661:Ppp6r2 UTSW 15 89253051 missense possibly damaging 0.96
R1867:Ppp6r2 UTSW 15 89281938 missense probably benign 0.01
R2081:Ppp6r2 UTSW 15 89282129 missense probably benign 0.01
R2291:Ppp6r2 UTSW 15 89275487 missense probably damaging 1.00
R2900:Ppp6r2 UTSW 15 89281995 missense probably damaging 1.00
R3805:Ppp6r2 UTSW 15 89265639 missense probably benign 0.30
R3965:Ppp6r2 UTSW 15 89259114 missense probably benign 0.20
R4374:Ppp6r2 UTSW 15 89265158 missense probably damaging 1.00
R4901:Ppp6r2 UTSW 15 89259069 missense possibly damaging 0.88
R5055:Ppp6r2 UTSW 15 89282949 missense probably benign 0.01
R5668:Ppp6r2 UTSW 15 89280399 missense probably damaging 1.00
R5739:Ppp6r2 UTSW 15 89259073 missense probably benign 0.02
R6026:Ppp6r2 UTSW 15 89282910 missense probably benign 0.02
R6058:Ppp6r2 UTSW 15 89253252 critical splice donor site probably null
R6488:Ppp6r2 UTSW 15 89268538 missense probably benign 0.12
R6631:Ppp6r2 UTSW 15 89253255 splice site probably null
R6633:Ppp6r2 UTSW 15 89253255 splice site probably null
R6744:Ppp6r2 UTSW 15 89256661 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCATAACTTGTCCCTCTCTGG -3'
(R):5'- TTTGCAAAGAGATCCTCAGGGAG -3'

Sequencing Primer
(F):5'- TCTGGACCAGCCCTTGC -3'
(R):5'- AGCTCTGCTGCGACATAGC -3'
Posted On2014-09-18