Incidental Mutation 'R2102:Gpr82'
ID230639
Institutional Source Beutler Lab
Gene Symbol Gpr82
Ensembl Gene ENSMUSG00000047678
Gene NameG protein-coupled receptor 82
Synonyms
MMRRC Submission 040106-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2102 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location13661363-13667433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13666035 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 274 (V274A)
Ref Sequence ENSEMBL: ENSMUSP00000062535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033321] [ENSMUST00000053659] [ENSMUST00000115436] [ENSMUST00000115438] [ENSMUST00000124710] [ENSMUST00000156096]
Predicted Effect probably benign
Transcript: ENSMUST00000033321
SMART Domains Protein: ENSMUSP00000033321
Gene: ENSMUSG00000031012

DomainStartEndE-ValueType
S_TKc 12 276 1.22e-100 SMART
L27 340 395 8.68e-14 SMART
L27 399 452 1.67e-15 SMART
PDZ 493 565 4.01e-14 SMART
SH3 597 663 1.75e-12 SMART
low complexity region 685 697 N/A INTRINSIC
GuKc 720 896 7.41e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053659
AA Change: V274A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000062535
Gene: ENSMUSG00000047678
AA Change: V274A

DomainStartEndE-ValueType
Pfam:7tm_1 32 310 5.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115436
SMART Domains Protein: ENSMUSP00000111096
Gene: ENSMUSG00000031012

DomainStartEndE-ValueType
S_TKc 12 276 1.22e-100 SMART
L27 340 395 8.68e-14 SMART
L27 399 452 1.67e-15 SMART
PDZ 493 565 4.01e-14 SMART
SH3 586 652 1.75e-12 SMART
low complexity region 674 686 N/A INTRINSIC
GuKc 709 885 7.41e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115438
SMART Domains Protein: ENSMUSP00000111098
Gene: ENSMUSG00000031012

DomainStartEndE-ValueType
S_TKc 12 276 1.22e-100 SMART
L27 340 395 8.68e-14 SMART
L27 399 452 1.67e-15 SMART
PDZ 493 565 4.01e-14 SMART
SH3 609 675 1.75e-12 SMART
low complexity region 697 709 N/A INTRINSIC
GuKc 732 908 7.41e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124710
SMART Domains Protein: ENSMUSP00000119584
Gene: ENSMUSG00000031012

DomainStartEndE-ValueType
Pfam:Pkinase 12 155 9.7e-33 PFAM
Pfam:Pkinase_Tyr 12 155 6.4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128012
SMART Domains Protein: ENSMUSP00000114187
Gene: ENSMUSG00000031012

DomainStartEndE-ValueType
Pfam:Pkinase 1 137 1.1e-32 PFAM
Pfam:Pkinase_Tyr 2 134 2.3e-10 PFAM
L27 207 249 1.81e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152358
Predicted Effect probably benign
Transcript: ENSMUST00000156096
SMART Domains Protein: ENSMUSP00000120299
Gene: ENSMUSG00000031012

DomainStartEndE-ValueType
S_TKc 1 250 2.71e-84 SMART
L27 314 369 8.68e-14 SMART
L27 373 426 1.67e-15 SMART
PDZ 467 539 4.01e-14 SMART
SH3 560 626 1.75e-12 SMART
low complexity region 648 660 N/A INTRINSIC
GuKc 683 859 7.41e-78 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an orphan G protein-coupled receptor of unknown function. The encoded protein is a member of a family of proteins that contain seven transmembrane domains and transduce extracellular signals through heterotrimeric G proteins. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,065,173 L41P probably damaging Het
1700061G19Rik T A 17: 56,884,949 Y542* probably null Het
3632451O06Rik A G 14: 49,774,002 Y83H probably damaging Het
Abca8a G T 11: 110,068,052 P749T probably damaging Het
Acad8 A T 9: 26,985,565 Y199* probably null Het
Acot12 A T 13: 91,759,977 I93L probably benign Het
Actn1 C A 12: 80,183,517 R321L probably benign Het
Ap3s1 A G 18: 46,754,402 E34G possibly damaging Het
Atp5a1 T C 18: 77,782,317 S533P probably damaging Het
Bcorl1 T C X: 48,369,204 V538A probably benign Het
Cdhr4 A G 9: 107,998,007 T689A probably damaging Het
Cdk19 A T 10: 40,479,730 probably benign Het
Cobll1 G T 2: 65,098,210 P923Q probably damaging Het
Cpt1a T C 19: 3,371,585 S456P probably benign Het
Cst11 T C 2: 148,771,240 Y55C probably damaging Het
Ctif T G 18: 75,521,381 D358A probably benign Het
Cyp2d34 T G 15: 82,616,773 E386A probably benign Het
Dcxr A G 11: 120,726,307 F104L probably benign Het
Dmbt1 G T 7: 131,102,032 W1107C probably damaging Het
Dsg1a A T 18: 20,333,773 I567F probably damaging Het
Ednrb T A 14: 103,820,914 R318* probably null Het
Exd2 T C 12: 80,480,603 I36T possibly damaging Het
Fam205c T A 4: 42,868,558 H355L probably benign Het
Fam83b A T 9: 76,492,705 I372N probably damaging Het
Fbxo18 A G 2: 11,758,289 V518A probably benign Het
Fkbp5 T C 17: 28,406,188 E308G possibly damaging Het
Foxl2 A C 9: 98,956,229 Y190S probably damaging Het
Gab3 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTC X: 74,999,979 probably benign Het
Galnt17 C T 5: 131,085,993 R223Q probably damaging Het
Gm10696 A T 3: 94,175,666 C279* probably null Het
Gm14496 G A 2: 181,991,334 D37N possibly damaging Het
Hsp90aa1 T C 12: 110,694,132 N292S probably damaging Het
Ints1 C T 5: 139,755,999 V1826M possibly damaging Het
Itgb4 A G 11: 116,005,735 D1440G probably benign Het
Kdm3b A G 18: 34,830,147 D1552G probably damaging Het
Kel G A 6: 41,686,484 T702I possibly damaging Het
Klf3 T C 5: 64,821,923 V36A probably damaging Het
Klhl23 A T 2: 69,828,884 I418F probably damaging Het
Kndc1 A T 7: 139,930,761 I1329L probably benign Het
Krtap2-4 T C 11: 99,614,780 probably benign Het
Krtap9-5 T A 11: 99,949,444 C324S unknown Het
Lepr T C 4: 101,772,981 V631A possibly damaging Het
Lifr T C 15: 7,186,923 I793T probably damaging Het
Mcoln1 G A 8: 3,511,731 R427H probably damaging Het
Mgat5b G A 11: 116,919,429 probably benign Het
Mmp12 G A 9: 7,349,802 V78M probably damaging Het
Mrgprb8 T A 7: 48,388,886 L102M possibly damaging Het
Mybphl A G 3: 108,375,633 T246A possibly damaging Het
Myo7b A T 18: 31,999,978 F439L probably damaging Het
Myom1 A T 17: 71,101,029 D1088V probably damaging Het
Nrcam T C 12: 44,576,688 F1004S probably benign Het
Palld A T 8: 61,533,433 M788K possibly damaging Het
Pappa T A 4: 65,316,228 Y1423* probably null Het
Pfkm A G 15: 98,129,290 K615E probably damaging Het
Pkd1l2 G T 8: 117,081,469 D105E probably damaging Het
Plekha5 G A 6: 140,572,877 A297T probably damaging Het
Plxnb1 T A 9: 109,115,742 M2051K probably damaging Het
Ppp6r2 A G 15: 89,278,746 T524A probably damaging Het
Psg26 T C 7: 18,475,142 E447G probably damaging Het
Rab3gap2 A G 1: 185,282,389 D1225G probably benign Het
Rep15 A G 6: 147,032,905 probably null Het
Rgl2 G A 17: 33,933,340 probably null Het
Rpl7a T G 2: 26,911,461 V55G possibly damaging Het
Rtp1 A T 16: 23,431,358 I158F probably benign Het
Scaper A T 9: 55,912,050 V127E probably benign Het
Sele T A 1: 164,053,826 C501S probably damaging Het
Serpina11 C T 12: 103,982,845 V358I probably benign Het
Slc16a4 A G 3: 107,304,503 probably null Het
Slco6c1 T C 1: 97,127,931 I82V probably benign Het
Smarca5 T C 8: 80,704,675 E971G probably damaging Het
Smr2 T C 5: 88,108,736 L91P probably damaging Het
Srrm2 A G 17: 23,817,748 probably benign Het
Syne1 A G 10: 5,056,514 W7980R probably damaging Het
Syne2 A G 12: 76,028,079 T4598A probably benign Het
Tmem171 A T 13: 98,692,343 F100I probably damaging Het
Tmem173 A T 18: 35,735,237 M270K probably damaging Het
Tnfrsf10b A G 14: 69,776,097 T159A probably benign Het
Tph1 A T 7: 46,660,410 probably null Het
Trim46 A T 3: 89,235,197 I638N probably damaging Het
Ubl7 G A 9: 57,920,542 D171N probably damaging Het
Utp20 A G 10: 88,772,917 Y1514H probably damaging Het
Vmn2r81 A G 10: 79,293,500 I742V probably damaging Het
Xrcc2 A T 5: 25,692,507 V148E probably damaging Het
Zbed3 A G 13: 95,336,107 D13G possibly damaging Het
Zdhhc25 T A 15: 88,600,759 L99Q probably benign Het
Other mutations in Gpr82
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0654:Gpr82 UTSW X 13665590 missense probably benign 0.02
R0656:Gpr82 UTSW X 13665590 missense probably benign 0.02
R3854:Gpr82 UTSW X 13665338 missense probably benign 0.21
R3856:Gpr82 UTSW X 13665338 missense probably benign 0.21
R4052:Gpr82 UTSW X 13665659 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCGGGTCTCATTGGAACC -3'
(R):5'- GTCAACCATATGTTAGAATGTGCAG -3'

Sequencing Primer
(F):5'- GGTCTCATTGGAACCACATTTATTGG -3'
(R):5'- GTGCAGTGAATTAAGATTTTGTAAGG -3'
Posted On2014-09-18