Incidental Mutation 'R2103:Reln'
ID230668
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21969360 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1948 (D1948E)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062372
AA Change: D1948E

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: D1948E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161356
AA Change: D1948E

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: D1948E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1907:Reln UTSW 5 22044962 critical splice donor site probably null
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTTTAGGCAAGGTTTCCTCC -3'
(R):5'- ATCACTGTGAATGTGCGGCC -3'

Sequencing Primer
(F):5'- CCTCCTGGTTTGTATGAAGCAATG -3'
(R):5'- TGAATGTGCGGCCATGAG -3'
Posted On2014-09-18