Incidental Mutation 'R2103:Cyp26b1'
ID230680
Institutional Source Beutler Lab
Gene Symbol Cyp26b1
Ensembl Gene ENSMUSG00000063415
Gene Namecytochrome P450, family 26, subfamily b, polypeptide 1
SynonymsP450RAI-2, CP26, retinoic acid B1
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2103 (G1)
Quality Score209
Status Not validated
Chromosome6
Chromosomal Location84571414-84593908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84575050 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 369 (S369P)
Ref Sequence ENSEMBL: ENSMUSP00000145092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077705] [ENSMUST00000168003] [ENSMUST00000204109] [ENSMUST00000204146] [ENSMUST00000205228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077705
AA Change: S369P

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076886
Gene: ENSMUSG00000063415
AA Change: S369P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168003
AA Change: S369P

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128391
Gene: ENSMUSG00000063415
AA Change: S369P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204109
AA Change: S294P

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144998
Gene: ENSMUSG00000063415
AA Change: S294P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:p450 65 415 5.8e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204146
AA Change: S369P

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145092
Gene: ENSMUSG00000063415
AA Change: S369P

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 50 490 8.1e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205228
AA Change: S178P

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144836
Gene: ENSMUSG00000063415
AA Change: S178P

DomainStartEndE-ValueType
Pfam:p450 13 299 5.9e-49 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein is localized to the endoplasmic reticulum, and functions as a critical regulator of all-trans retinoic acid levels by the specific inactivation of all-trans retinoic acid to hydroxylated forms. Mutations in this gene are associated with radiohumeral fusions and other skeletal and craniofacial anomalies, and increased levels of the encoded protein are associated with atherosclerotic lesions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Limb morphogenesis and proximal-distal patterning is disrupted in homozygous null fetuses. Mutant mice are born, however they die immediately after birth exhibiting respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Cyp26b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01713:Cyp26b1 APN 6 84574301 missense probably benign 0.00
IGL02530:Cyp26b1 APN 6 84574312 missense possibly damaging 0.95
IGL02624:Cyp26b1 APN 6 84584339 missense probably benign 0.00
IGL02676:Cyp26b1 APN 6 84576644 missense probably damaging 1.00
R0125:Cyp26b1 UTSW 6 84574515 missense probably damaging 1.00
R0127:Cyp26b1 UTSW 6 84577208 splice site probably benign
R0268:Cyp26b1 UTSW 6 84574572 missense probably damaging 1.00
R0281:Cyp26b1 UTSW 6 84574556 missense probably damaging 1.00
R0575:Cyp26b1 UTSW 6 84575306 splice site probably benign
R1167:Cyp26b1 UTSW 6 84584330 missense probably damaging 1.00
R1171:Cyp26b1 UTSW 6 84576671 missense possibly damaging 0.64
R1512:Cyp26b1 UTSW 6 84576997 missense probably benign 0.16
R1791:Cyp26b1 UTSW 6 84584459 missense probably benign 0.05
R1799:Cyp26b1 UTSW 6 84584272 missense probably benign 0.37
R2065:Cyp26b1 UTSW 6 84576555 missense probably benign 0.00
R2900:Cyp26b1 UTSW 6 84576641 missense possibly damaging 0.70
R4510:Cyp26b1 UTSW 6 84574491 missense probably damaging 1.00
R4511:Cyp26b1 UTSW 6 84574491 missense probably damaging 1.00
R4934:Cyp26b1 UTSW 6 84576972 missense possibly damaging 0.65
R5585:Cyp26b1 UTSW 6 84577189 missense probably damaging 0.99
X0063:Cyp26b1 UTSW 6 84575118 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACAGGTTGGCTTCACTCAG -3'
(R):5'- AAAACACCCTGCTGTGCTG -3'

Sequencing Primer
(F):5'- GCATTTAGGGTGAAGCCTCTCC -3'
(R):5'- CTGGAGAAGCTGAGGGAGGAAC -3'
Posted On2014-09-18