Incidental Mutation 'R2103:Vwf'
ID230681
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene NameVon Willebrand factor
Synonyms6820430P06Rik, B130011O06Rik
MMRRC Submission 040107-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125546774-125686679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125646330 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1797 (V1797I)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
Predicted Effect probably benign
Transcript: ENSMUST00000001995
AA Change: V1797I

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000001995
Gene: ENSMUSG00000001930
AA Change: V1797I

DomainStartEndE-ValueType
VWD 20 178 3.43e-35 SMART
C8 218 292 1.11e-21 SMART
Pfam:TIL 295 348 2.9e-14 PFAM
VWC 350 410 8.71e-1 SMART
VWD 377 540 2.93e-52 SMART
C8 577 649 3.82e-25 SMART
Pfam:TIL 652 707 5.7e-14 PFAM
EGF_like 787 822 4.37e1 SMART
VWC 829 898 3.29e-3 SMART
VWD 856 1012 5.15e-39 SMART
C8 1053 1127 1.01e-33 SMART
Pfam:TIL 1141 1196 3.6e-9 PFAM
VWA 1275 1458 1.81e-20 SMART
low complexity region 1461 1474 N/A INTRINSIC
VWA 1496 1669 8.43e-39 SMART
VWA 1689 1872 2.83e-31 SMART
VWC 1879 1946 2.99e0 SMART
VWD 1938 2101 5.03e-42 SMART
C8 2132 2200 1.29e-13 SMART
Pfam:TIL 2203 2254 1.2e-7 PFAM
VWC 2257 2325 3.16e-16 SMART
low complexity region 2414 2425 N/A INTRINSIC
VWC 2431 2494 2.61e-17 SMART
VWC 2510 2574 3.37e0 SMART
VWC 2582 2644 2.55e-11 SMART
CT 2727 2812 1.37e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112254
AA Change: V1797I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: V1797I

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141521
Predicted Effect probably benign
Transcript: ENSMUST00000147101
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 intron probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 intron probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense unknown
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense unknown
R5642:Vwf UTSW 6 125603418 missense unknown
R5860:Vwf UTSW 6 125643090 missense unknown
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense unknown
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Predicted Primers PCR Primer
(F):5'- TCCCACCAAGTATTGTTCTGAGTC -3'
(R):5'- GGTGAGGAGTCTGAATGCTGAC -3'

Sequencing Primer
(F):5'- GTATTGTTCTGAGTCATAACTGCTC -3'
(R):5'- ACCTAGCTCAGCAGTAGACTGTTTG -3'
Posted On2014-09-18