Incidental Mutation 'R2103:Ano5'
ID230686
Institutional Source Beutler Lab
Gene Symbol Ano5
Ensembl Gene ENSMUSG00000055489
Gene Nameanoctamin 5
SynonymsGdd1, Tmem16e
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location51511029-51598709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51537813 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 50 (K50R)
Ref Sequence ENSEMBL: ENSMUSP00000147243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043944] [ENSMUST00000207044] [ENSMUST00000207717]
Predicted Effect probably benign
Transcript: ENSMUST00000043944
AA Change: K83R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000046884
Gene: ENSMUSG00000055489
AA Change: K83R

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Anoct_dimer 64 280 7.7e-70 PFAM
Pfam:Anoctamin 283 860 6.5e-138 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207044
AA Change: K50R

PolyPhen 2 Score 0.594 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000207717
AA Change: K69R

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.022 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. Elevated levels of this protein were found in dystrophic mice. In humans, mutations of this gene are associated with with musculoskeletal disorders such as myopathies, muscular dystrophy and gnathodiaphyseal dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: One type of homozygous KO causes abnormalities in skeletal muscle mitochondria and impairs muscle regeneration and repair, leading to exercise intolerance. Another type of homozygous KO impairs sperm motility, leading to male subfertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Ano5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Ano5 APN 7 51566513 missense probably damaging 0.96
IGL01328:Ano5 APN 7 51556271 critical splice donor site probably null
IGL01800:Ano5 APN 7 51573075 critical splice donor site probably null
IGL01888:Ano5 APN 7 51566300 missense probably benign 0.06
IGL02221:Ano5 APN 7 51570323 missense probably damaging 1.00
IGL02538:Ano5 APN 7 51583775 missense probably damaging 1.00
IGL03027:Ano5 APN 7 51566277 missense probably damaging 0.99
IGL03133:Ano5 APN 7 51576512 nonsense probably null
IGL03167:Ano5 APN 7 51585511 missense probably damaging 0.98
IGL03233:Ano5 APN 7 51570368 missense probably damaging 1.00
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0233:Ano5 UTSW 7 51535470 missense possibly damaging 0.94
R0675:Ano5 UTSW 7 51574810 missense probably damaging 1.00
R0723:Ano5 UTSW 7 51587758 missense probably benign 0.20
R0764:Ano5 UTSW 7 51537842 splice site probably benign
R1159:Ano5 UTSW 7 51579474 splice site probably benign
R1218:Ano5 UTSW 7 51570421 splice site probably null
R1288:Ano5 UTSW 7 51546872 missense probably damaging 1.00
R1329:Ano5 UTSW 7 51546785 missense probably benign
R1484:Ano5 UTSW 7 51566320 missense probably damaging 1.00
R1496:Ano5 UTSW 7 51583775 missense probably damaging 1.00
R1512:Ano5 UTSW 7 51579568 missense probably benign 0.00
R1691:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R1859:Ano5 UTSW 7 51546833 missense probably damaging 1.00
R1991:Ano5 UTSW 7 51537813 missense possibly damaging 0.59
R2066:Ano5 UTSW 7 51585386 missense probably damaging 1.00
R2088:Ano5 UTSW 7 51587706 missense possibly damaging 0.50
R2248:Ano5 UTSW 7 51593789 missense probably benign 0.00
R3692:Ano5 UTSW 7 51590579 missense probably damaging 1.00
R3723:Ano5 UTSW 7 51576528 missense probably damaging 1.00
R3805:Ano5 UTSW 7 51576650 missense probably benign 0.22
R3883:Ano5 UTSW 7 51566304 missense probably damaging 1.00
R3978:Ano5 UTSW 7 51587806 missense probably benign
R4035:Ano5 UTSW 7 51566485 splice site probably benign
R4239:Ano5 UTSW 7 51587666 missense probably damaging 0.99
R4466:Ano5 UTSW 7 51570275 missense probably damaging 1.00
R4644:Ano5 UTSW 7 51587685 nonsense probably null
R5021:Ano5 UTSW 7 51556185 missense probably benign
R5028:Ano5 UTSW 7 51537710 splice site probably null
R5609:Ano5 UTSW 7 51593637 missense probably damaging 1.00
R5659:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5660:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5680:Ano5 UTSW 7 51583814 missense possibly damaging 0.94
R5786:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5787:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5788:Ano5 UTSW 7 51566318 missense possibly damaging 0.88
R5856:Ano5 UTSW 7 51585326 missense probably benign 0.01
R5930:Ano5 UTSW 7 51585331 missense probably damaging 0.99
R5984:Ano5 UTSW 7 51593664 missense probably damaging 1.00
R6015:Ano5 UTSW 7 51574777 missense probably benign 0.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6030:Ano5 UTSW 7 51574825 missense probably damaging 1.00
R6247:Ano5 UTSW 7 51566131 intron probably null
X0062:Ano5 UTSW 7 51593651 nonsense probably null
X0065:Ano5 UTSW 7 51576628 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCAGTGTCCCAATTAGAGC -3'
(R):5'- GTGGGGTCACGCTTGATATC -3'

Sequencing Primer
(F):5'- CAGTGTCCCAATTAGAGCTAAGTTCC -3'
(R):5'- GGGTCACGCTTGATATCTAAAGC -3'
Posted On2014-09-18