Incidental Mutation 'R2103:Whamm'
ID230688
Institutional Source Beutler Lab
Gene Symbol Whamm
Ensembl Gene ENSMUSG00000045795
Gene NameWAS protein homolog associated with actin, golgi membranes and microtubules
SynonymsWhdc1
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location81571266-81596836 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 81591771 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 277 (R277*)
Ref Sequence ENSEMBL: ENSMUSP00000146854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165460] [ENSMUST00000207123] [ENSMUST00000209044]
Predicted Effect probably null
Transcript: ENSMUST00000165460
AA Change: R483*
SMART Domains Protein: ENSMUSP00000128881
Gene: ENSMUSG00000045795
AA Change: R483*

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 54 1.1e-30 PFAM
Pfam:JMY 67 435 1.3e-157 PFAM
coiled coil region 448 470 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 631 656 N/A INTRINSIC
WH2 698 716 5.69e2 SMART
WH2 728 745 6.26e-2 SMART
coiled coil region 758 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208537
Predicted Effect probably null
Transcript: ENSMUST00000209044
AA Change: R277*
Meta Mutation Damage Score 0.6392 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in actin nucleation, Golgi membrane association and microtubule binding. The encoded protein is a nucleation-promoting factor that regulates the Actin-related protein 2/3 complex. The activated complex initiates growth of new actin filaments by binding to existing actin filaments. The encoded protein also functions in regulation of transport from the endoplasmic reticulum to the Golgi complex and in maintenance of the Golgi complex near the centrosome. Four pseudogenes of this gene are present on the same arm of chromosome 15 as this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Whamm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Whamm APN 7 81578266 missense probably damaging 1.00
IGL01139:Whamm APN 7 81595914 missense probably damaging 1.00
IGL01870:Whamm APN 7 81595974 missense probably damaging 0.96
IGL03153:Whamm APN 7 81589532 splice site probably benign
R0179:Whamm UTSW 7 81594015 missense probably benign 0.00
R0364:Whamm UTSW 7 81594051 missense probably benign 0.00
R0550:Whamm UTSW 7 81586224 missense possibly damaging 0.55
R0682:Whamm UTSW 7 81586138 missense probably damaging 1.00
R1388:Whamm UTSW 7 81586290 missense probably damaging 1.00
R1940:Whamm UTSW 7 81578299 missense probably null 0.64
R1991:Whamm UTSW 7 81591771 nonsense probably null
R1992:Whamm UTSW 7 81591771 nonsense probably null
R2104:Whamm UTSW 7 81591771 nonsense probably null
R2162:Whamm UTSW 7 81571341 missense probably damaging 1.00
R2291:Whamm UTSW 7 81591771 nonsense probably null
R3078:Whamm UTSW 7 81571784 missense probably damaging 1.00
R4735:Whamm UTSW 7 81571374 missense probably benign 0.01
R6336:Whamm UTSW 7 81591764 missense probably damaging 1.00
R6723:Whamm UTSW 7 81596120 missense probably damaging 1.00
R6747:Whamm UTSW 7 81578302 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCCGTCCCTTGTCAAAAG -3'
(R):5'- AGCCGCTCAAGGGTTTTCTG -3'

Sequencing Primer
(F):5'- TCCCTTGTCAAAAGACTGTGGAG -3'
(R):5'- TCCTTGTAAAATGCCCATAATTCCAC -3'
Posted On2014-09-18