Incidental Mutation 'R2103:Il10ra'
ID230699
Institutional Source Beutler Lab
Gene Symbol Il10ra
Ensembl Gene ENSMUSG00000032089
Gene Nameinterleukin 10 receptor, alpha
SynonymsCDw210, Il10r, mIL-10R
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45253837-45269149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45255811 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 481 (A481S)
Ref Sequence ENSEMBL: ENSMUSP00000135461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034594] [ENSMUST00000176222] [ENSMUST00000176808]
Predicted Effect probably benign
Transcript: ENSMUST00000034594
AA Change: A483S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034594
Gene: ENSMUSG00000032089
AA Change: A483S

DomainStartEndE-ValueType
Pfam:Tissue_fac 5 114 3.3e-29 PFAM
SCOP:d1lqsr2 125 231 5e-59 SMART
transmembrane domain 239 261 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176222
AA Change: A481S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135461
Gene: ENSMUSG00000032089
AA Change: A481S

DomainStartEndE-ValueType
Pfam:Tissue_fac 2 112 3.5e-26 PFAM
SCOP:d1lqsr2 123 229 5e-59 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 480 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176808
SMART Domains Protein: ENSMUSP00000135361
Gene: ENSMUSG00000032089

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for an ENU-generated null allele suffer from a severe inflammatory bowel syndrome. Mice heterozygote for an NZW variant allele have high sera levels of anti-chromatin antibodies. Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Il10ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Il10ra APN 9 45267160 missense probably damaging 1.00
IGL01916:Il10ra APN 9 45256146 missense probably damaging 1.00
IGL03067:Il10ra APN 9 45255859 missense probably benign 0.01
R0081:Il10ra UTSW 9 45255949 missense probably benign 0.04
R0266:Il10ra UTSW 9 45265652 missense probably benign 0.11
R1734:Il10ra UTSW 9 45255943 missense probably benign 0.02
R1901:Il10ra UTSW 9 45256356 missense probably benign 0.39
R1991:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2218:Il10ra UTSW 9 45265616 missense probably benign
R4686:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R4908:Il10ra UTSW 9 45255621 missense probably benign 0.21
R4982:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R5590:Il10ra UTSW 9 45265626 nonsense probably null
R5739:Il10ra UTSW 9 45256070 missense possibly damaging 0.65
R5872:Il10ra UTSW 9 45255653 missense possibly damaging 0.92
R6053:Il10ra UTSW 9 45256303 missense probably damaging 0.99
R6282:Il10ra UTSW 9 45260405 missense probably damaging 0.98
R6798:Il10ra UTSW 9 45256432 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTATGGGCAAACCTCCAACTTTC -3'
(R):5'- GCAGCCTAAGTACACACAGG -3'

Sequencing Primer
(F):5'- GGGCAAACCTCCAACTTTCTATGC -3'
(R):5'- ACACAGGATGCATCTGCCTTG -3'
Posted On2014-09-18