Incidental Mutation 'R2103:Mrps34'
ID230738
Institutional Source Beutler Lab
Gene Symbol Mrps34
Ensembl Gene ENSMUSG00000038880
Gene Namemitochondrial ribosomal protein S34
SynonymsTce2, 0610007F04Rik, 5330430D13Rik
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R2103 (G1)
Quality Score95
Status Not validated
Chromosome17
Chromosomal Location24895116-24897502 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 24895490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000068508] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000117890] [ENSMUST00000119115] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120035] [ENSMUST00000120943] [ENSMUST00000121542] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000130194] [ENSMUST00000139754] [ENSMUST00000146923] [ENSMUST00000154236] [ENSMUST00000168265] [ENSMUST00000178969]
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably null
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088345
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115229
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117509
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119115
SMART Domains Protein: ENSMUSP00000112955
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.3e-72 PFAM
low complexity region 229 238 N/A INTRINSIC
PDB:2W83|D 385 440 7e-20 PDB
coiled coil region 493 523 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 722 737 N/A INTRINSIC
low complexity region 861 869 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
SCOP:d1flga_ 955 1135 3e-8 SMART
Blast:WD40 1043 1084 5e-18 BLAST
low complexity region 1228 1244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119848
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120035
SMART Domains Protein: ENSMUSP00000114084
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 235 248 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
PDB:2W83|D 416 471 6e-20 PDB
coiled coil region 524 554 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 892 900 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
SCOP:d1flga_ 986 1166 3e-8 SMART
Blast:WD40 1074 1115 6e-18 BLAST
low complexity region 1259 1275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121542
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121723
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121787
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145882
Predicted Effect probably benign
Transcript: ENSMUST00000146923
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156663
Predicted Effect probably benign
Transcript: ENSMUST00000168265
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178969
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit mitochondrial malfunction with cardiac hypertrophy and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Mrps34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mrps34 APN 17 24895370 missense probably damaging 0.99
IGL01481:Mrps34 APN 17 24897336 unclassified probably benign
IGL02615:Mrps34 APN 17 24895793 unclassified probably null
IGL02693:Mrps34 APN 17 24895198 missense probably benign 0.32
R0096:Mrps34 UTSW 17 24895669 missense probably damaging 0.98
R0096:Mrps34 UTSW 17 24895669 missense probably damaging 0.98
X0021:Mrps34 UTSW 17 24895187 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGACTACGAGACGCTGACC -3'
(R):5'- CCTTTGAAAGTCAGGATGCCCC -3'

Sequencing Primer
(F):5'- GAGACGCTGACCCGGCC -3'
(R):5'- CGTGGTCCAAGTTCTGCAG -3'
Posted On2014-09-18