Incidental Mutation 'R2103:Tpsg1'
ID230739
Institutional Source Beutler Lab
Gene Symbol Tpsg1
Ensembl Gene ENSMUSG00000033200
Gene Nametryptase gamma 1
SynonymsTMT, Prss31
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25369273-25374442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25373293 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 41 (S41P)
Ref Sequence ENSEMBL: ENSMUSP00000123828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024999] [ENSMUST00000078496] [ENSMUST00000159048] [ENSMUST00000159610] [ENSMUST00000160377] [ENSMUST00000160485] [ENSMUST00000160920] [ENSMUST00000162021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024999
AA Change: S114P

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024999
Gene: ENSMUSG00000033200
AA Change: S114P

DomainStartEndE-ValueType
Tryp_SPc 29 257 1.06e-87 SMART
transmembrane domain 274 296 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078496
SMART Domains Protein: ENSMUSP00000077586
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 138 418 8.4e-65 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 824 1011 4.7e-46 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1341 1565 4.5e-56 PFAM
low complexity region 1576 1602 N/A INTRINSIC
Pfam:Ion_trans 1656 1864 7.8e-48 PFAM
Pfam:PKD_channel 1714 1871 1.2e-10 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159048
SMART Domains Protein: ENSMUSP00000123741
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 32 312 8e-65 PFAM
low complexity region 394 405 N/A INTRINSIC
low complexity region 409 425 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 602 617 N/A INTRINSIC
Pfam:Ion_trans 718 905 4.6e-46 PFAM
low complexity region 1024 1041 N/A INTRINSIC
low complexity region 1142 1153 N/A INTRINSIC
Pfam:Ion_trans 1235 1459 4.3e-56 PFAM
low complexity region 1470 1496 N/A INTRINSIC
Pfam:PKD_channel 1524 1608 1.6e-6 PFAM
Pfam:Ion_trans 1550 1758 7.6e-48 PFAM
Pfam:PKD_channel 1609 1765 1.2e-10 PFAM
Blast:Tryp_SPc 1809 1854 9e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159331
Predicted Effect probably benign
Transcript: ENSMUST00000159610
SMART Domains Protein: ENSMUSP00000125541
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:Ion_trans 99 430 7e-79 PFAM
low complexity region 500 511 N/A INTRINSIC
low complexity region 515 531 N/A INTRINSIC
low complexity region 557 568 N/A INTRINSIC
low complexity region 708 723 N/A INTRINSIC
Pfam:Ion_trans 789 1023 2.4e-58 PFAM
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
Pfam:Ion_trans 1304 1577 4.5e-65 PFAM
Pfam:Ion_trans 1621 1876 4.2e-59 PFAM
Pfam:PKD_channel 1629 1715 9.3e-7 PFAM
Pfam:PKD_channel 1713 1871 2.2e-11 PFAM
Blast:Tryp_SPc 1915 2077 1e-38 BLAST
low complexity region 2086 2097 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160377
AA Change: S11P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124008
Gene: ENSMUSG00000033200
AA Change: S11P

DomainStartEndE-ValueType
Tryp_SPc 4 154 1.79e-30 SMART
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160485
AA Change: S11P

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124721
Gene: ENSMUSG00000033200
AA Change: S11P

DomainStartEndE-ValueType
Tryp_SPc 4 154 1.79e-30 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000160920
AA Change: S41P

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123828
Gene: ENSMUSG00000033200
AA Change: S41P

DomainStartEndE-ValueType
Tryp_SPc 1 184 7.18e-44 SMART
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161035
SMART Domains Protein: ENSMUSP00000123906
Gene: ENSMUSG00000024112

DomainStartEndE-ValueType
Pfam:Ion_trans 1 73 2.1e-9 PFAM
Pfam:Ion_trans 72 170 2.8e-17 PFAM
Blast:Tryp_SPc 209 291 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161658
Predicted Effect probably benign
Transcript: ENSMUST00000162021
SMART Domains Protein: ENSMUSP00000125180
Gene: ENSMUSG00000033200

DomainStartEndE-ValueType
Tryp_SPc 5 111 2.35e-4 SMART
transmembrane domain 128 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. There is uncertainty regarding the number of genes in this cluster. Currently four functional genes - alpha I, beta I, beta II and gamma I - have been identified. And beta I has an allelic variant named alpha II, beta II has an allelic variant beta III, also gamma I has an allelic variant gamma II. Beta tryptases appear to be the main isoenzymes expressed in mast cells; whereas in basophils, alpha-tryptases predominant. This gene differs from other members of the tryptase gene family in that it has C-terminal hydrophobic domain, which may serve as a membrane anchor. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plce1 T C 19: 38,777,924 F2117S probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Tpsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Tpsg1 APN 17 25373222 missense probably benign 0.36
IGL01445:Tpsg1 APN 17 25372498 nonsense probably null
IGL01515:Tpsg1 APN 17 25373962 missense probably damaging 1.00
R0095:Tpsg1 UTSW 17 25372554 missense probably damaging 1.00
R1155:Tpsg1 UTSW 17 25373794 missense possibly damaging 0.71
R1911:Tpsg1 UTSW 17 25373400 missense probably benign 0.01
R2280:Tpsg1 UTSW 17 25374042 missense probably damaging 1.00
R4843:Tpsg1 UTSW 17 25370617 start gained probably benign
R6142:Tpsg1 UTSW 17 25372486 missense probably benign
R6381:Tpsg1 UTSW 17 25372569 missense probably damaging 1.00
R6597:Tpsg1 UTSW 17 25369297 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGCAGTAGCTGTTTCTGTGC -3'
(R):5'- CCACTAGGAGCAAAGCAGTG -3'

Sequencing Primer
(F):5'- TGCCTAGCACCGAGGATAG -3'
(R):5'- CAAAGCAGTGGCACCAGTG -3'
Posted On2014-09-18