Incidental Mutation 'R2103:Plce1'
ID230746
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Namephospholipase C, epsilon 1
Synonyms4933403A21Rik, PLCepsilon
MMRRC Submission 040107-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R2103 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38481109-38785030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38777924 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 2117 (F2117S)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: F2117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: F2117S

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182267
AA Change: F2131S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: F2131S

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: F2117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: F2117S

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182589
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac C A 3: 60,039,814 P311Q probably damaging Het
Acoxl T A 2: 127,972,606 M314K probably damaging Het
Agmat A T 4: 141,755,903 D216V probably damaging Het
Aida A T 1: 183,313,692 E107D probably benign Het
Ano5 A G 7: 51,537,813 K50R possibly damaging Het
Anxa2 A T 9: 69,483,816 D95V probably damaging Het
Aspm G A 1: 139,491,665 V3023M probably damaging Het
Atg16l2 A G 7: 101,290,361 probably null Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
B3galt5 A T 16: 96,316,025 K286M probably damaging Het
Best3 A C 10: 117,002,594 I186L probably benign Het
Blm G T 7: 80,505,949 probably null Het
Cat A T 2: 103,463,315 D389E probably damaging Het
Cluh C A 11: 74,659,529 C222* probably null Het
Cntnap2 G A 6: 47,298,588 E1325K probably damaging Het
Col14a1 A T 15: 55,449,940 D1320V unknown Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Cpne7 A G 8: 123,127,437 K288E possibly damaging Het
Cyp26b1 A G 6: 84,575,050 S369P possibly damaging Het
Cyp2j9 T A 4: 96,571,964 K434M probably damaging Het
Dpyd G C 3: 119,064,952 S605T probably benign Het
Dst A G 1: 34,190,258 T1986A probably benign Het
Ebf2 T A 14: 67,387,942 V233D probably damaging Het
Ecm2 A G 13: 49,530,256 D570G probably benign Het
Efhc1 T A 1: 20,989,560 C611* probably null Het
Epop T C 11: 97,628,654 T210A probably benign Het
Fdxacb1 A T 9: 50,771,646 N101I probably benign Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Galnt16 A G 12: 80,583,656 D262G probably damaging Het
Gm9507 T A 10: 77,811,666 probably benign Het
Grin2b A T 6: 135,780,140 I441N probably benign Het
H2-Eb2 A G 17: 34,334,304 I155V probably benign Het
Hectd4 C A 5: 121,355,629 D3811E probably benign Het
Herc4 T C 10: 63,246,110 S71P probably benign Het
Hhipl1 A G 12: 108,327,718 T628A probably benign Het
Hoga1 A C 19: 42,060,020 probably null Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Il10ra C A 9: 45,255,811 A481S probably benign Het
Klk1b26 A T 7: 44,016,900 T256S probably damaging Het
Kndc1 C T 7: 139,921,234 T813I probably benign Het
Limch1 A G 5: 66,998,729 K394R probably benign Het
Lrrc37a T C 11: 103,500,261 E1446G probably benign Het
Lrrc47 C T 4: 154,015,893 R287W probably damaging Het
Mdn1 T A 4: 32,738,712 L3555Q possibly damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mei1 G T 15: 82,107,036 V472F probably damaging Het
Mrps34 T A 17: 24,895,490 probably null Het
Myom3 A G 4: 135,776,412 T391A probably benign Het
Nfib G A 4: 82,330,408 T314I possibly damaging Het
Olfr1451 T C 19: 12,999,502 V172A possibly damaging Het
Olfr459 A G 6: 41,772,005 I98T probably benign Het
Olfr498 A G 7: 108,465,603 N93S probably benign Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
Pdia3 G C 2: 121,433,993 G346A probably damaging Het
Plec A G 15: 76,173,543 F4055L probably damaging Het
Ppip5k1 A T 2: 121,321,653 probably null Het
Psma6 T C 12: 55,408,057 I57T probably benign Het
Psme2 A T 14: 55,590,840 probably null Het
Reln A T 5: 21,969,360 D1948E possibly damaging Het
Rsf1 GGCG GGCGACGGCAGCG 7: 97,579,906 probably benign Het
Sbno1 G T 5: 124,393,937 S727R probably damaging Het
Serpina3m C A 12: 104,389,699 Y208* probably null Het
Serpind1 T C 16: 17,342,944 V446A probably benign Het
Shc3 T A 13: 51,442,836 M384L probably benign Het
Slc38a11 A G 2: 65,330,339 F304L probably benign Het
Slc4a5 A C 6: 83,224,681 D4A probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slpi C T 2: 164,355,543 C28Y probably damaging Het
Sptan1 T C 2: 30,030,471 S2320P probably damaging Het
Stim2 A G 5: 54,105,249 T278A possibly damaging Het
Sympk T A 7: 19,054,116 S1186T probably benign Het
Tbrg1 T C 9: 37,649,419 D387G probably benign Het
Tns2 A T 15: 102,112,665 probably null Het
Tnxb A G 17: 34,682,251 Y1013C probably damaging Het
Tpsg1 T C 17: 25,373,293 S41P possibly damaging Het
Trim36 T C 18: 46,196,082 N85S probably benign Het
Trpm6 A T 19: 18,796,284 H380L probably benign Het
Tssk4 A G 14: 55,651,540 I174M probably damaging Het
Ttn C T 2: 76,946,391 probably null Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r4 T A 3: 64,415,283 N5I possibly damaging Het
Vps11 G A 9: 44,359,227 H183Y probably damaging Het
Vsig10l A G 7: 43,467,468 T476A possibly damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wasl A T 6: 24,618,378 S447T unknown Het
Whamm C T 7: 81,591,771 R277* probably null Het
Zfp874a T A 13: 67,442,504 I354F probably benign Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38720996 missense probably damaging 1.00
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R5452:Plce1 UTSW 19 38620482 missense probably benign 0.01
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6317:Plce1 UTSW 19 38524530 nonsense probably null
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 unclassified probably null
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CAGGGTGCATGCAAAAGATC -3'
(R):5'- TTATATCAAGGAGTCATGGGGTGAG -3'

Sequencing Primer
(F):5'- AAGGTGATGTTTCCCATATTGCC -3'
(R):5'- TGAGGAAAGGGGAGATTCTCATG -3'
Posted On2014-09-18