Incidental Mutation 'R2104:Casp8ap2'
ID230764
Institutional Source Beutler Lab
Gene Symbol Casp8ap2
Ensembl Gene ENSMUSG00000028282
Gene Namecaspase 8 associated protein 2
SynonymsFLASH, D4Ertd659e
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32615451-32653265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32644727 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1267 (S1267P)
Ref Sequence ENSEMBL: ENSMUSP00000136016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029950] [ENSMUST00000108178] [ENSMUST00000178925]
Predicted Effect probably benign
Transcript: ENSMUST00000029950
AA Change: S1267P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029950
Gene: ENSMUSG00000028282
AA Change: S1267P

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108178
SMART Domains Protein: ENSMUSP00000103813
Gene: ENSMUSG00000028282

DomainStartEndE-ValueType
PDB:2LR8|A 126 190 4e-26 PDB
Blast:SANT 139 183 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000178925
AA Change: S1267P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000136016
Gene: ENSMUSG00000028282
AA Change: S1267P

DomainStartEndE-ValueType
coiled coil region 68 142 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 458 477 N/A INTRINSIC
low complexity region 1124 1135 N/A INTRINSIC
low complexity region 1250 1268 N/A INTRINSIC
low complexity region 1360 1377 N/A INTRINSIC
low complexity region 1458 1470 N/A INTRINSIC
low complexity region 1477 1498 N/A INTRINSIC
low complexity region 1882 1895 N/A INTRINSIC
PDB:2LR8|A 1896 1962 1e-31 PDB
Blast:SANT 1905 1955 2e-21 BLAST
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is highly similar to FLASH, a mouse apoptotic protein identified by its interaction with the death-effector domain (DED) of caspase 8. Studies of FLASH protein suggested that this protein may be a component of the death-inducing signaling complex that includes Fas receptor, Fas-binding adapter FADD, and caspase 8, and plays a regulatory role in Fas-mediated apoptosis. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Casp8ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00686:Casp8ap2 APN 4 32641433 missense probably damaging 1.00
IGL00714:Casp8ap2 APN 4 32649192 missense probably damaging 1.00
IGL00754:Casp8ap2 APN 4 32641036 missense probably benign 0.00
IGL00954:Casp8ap2 APN 4 32645403 missense probably damaging 1.00
IGL00970:Casp8ap2 APN 4 32646182 missense probably benign
IGL01534:Casp8ap2 APN 4 32648134 splice site probably benign
IGL01596:Casp8ap2 APN 4 32646365 missense probably damaging 1.00
IGL01686:Casp8ap2 APN 4 32641294 missense possibly damaging 0.94
IGL02002:Casp8ap2 APN 4 32639391 missense probably damaging 1.00
IGL02273:Casp8ap2 APN 4 32643974 missense probably damaging 1.00
IGL02510:Casp8ap2 APN 4 32639704 missense probably benign 0.05
IGL02600:Casp8ap2 APN 4 32630246 missense probably null 1.00
IGL02929:Casp8ap2 APN 4 32624105 utr 5 prime probably benign
F5770:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
IGL02988:Casp8ap2 UTSW 4 32644590 missense probably benign 0.14
R0023:Casp8ap2 UTSW 4 32640185 missense probably damaging 0.99
R0027:Casp8ap2 UTSW 4 32643810 missense probably benign 0.01
R0090:Casp8ap2 UTSW 4 32640327 missense probably damaging 1.00
R0117:Casp8ap2 UTSW 4 32640817 missense probably benign 0.00
R0144:Casp8ap2 UTSW 4 32643797 missense possibly damaging 0.50
R0268:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0344:Casp8ap2 UTSW 4 32644079 missense probably damaging 0.99
R0555:Casp8ap2 UTSW 4 32640381 missense probably damaging 1.00
R1051:Casp8ap2 UTSW 4 32640790 missense probably benign 0.28
R1165:Casp8ap2 UTSW 4 32640563 missense probably benign 0.01
R1243:Casp8ap2 UTSW 4 32645687 missense probably benign 0.03
R1311:Casp8ap2 UTSW 4 32648111 missense probably damaging 0.98
R1337:Casp8ap2 UTSW 4 32645721 missense possibly damaging 0.64
R1471:Casp8ap2 UTSW 4 32639386 nonsense probably null
R1497:Casp8ap2 UTSW 4 32639938 missense probably benign 0.00
R1521:Casp8ap2 UTSW 4 32631867 missense probably damaging 1.00
R1588:Casp8ap2 UTSW 4 32640541 missense probably benign 0.00
R1625:Casp8ap2 UTSW 4 32648068 missense probably benign 0.04
R1731:Casp8ap2 UTSW 4 32641442 missense possibly damaging 0.94
R1899:Casp8ap2 UTSW 4 32643647 missense probably damaging 0.98
R2000:Casp8ap2 UTSW 4 32634874 missense probably damaging 1.00
R2021:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2022:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2023:Casp8ap2 UTSW 4 32644560 missense probably benign 0.05
R2088:Casp8ap2 UTSW 4 32631126 missense probably damaging 1.00
R2128:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2129:Casp8ap2 UTSW 4 32640142 missense probably benign 0.06
R2305:Casp8ap2 UTSW 4 32646411 missense probably damaging 1.00
R2316:Casp8ap2 UTSW 4 32643781 missense probably benign 0.31
R2919:Casp8ap2 UTSW 4 32645343 missense probably damaging 1.00
R4091:Casp8ap2 UTSW 4 32643611 missense probably damaging 1.00
R4357:Casp8ap2 UTSW 4 32646150 missense probably benign 0.00
R4807:Casp8ap2 UTSW 4 32644505 missense possibly damaging 0.89
R4828:Casp8ap2 UTSW 4 32639807 missense probably benign
R4908:Casp8ap2 UTSW 4 32639905 missense possibly damaging 0.90
R4945:Casp8ap2 UTSW 4 32631163 missense possibly damaging 0.57
R4962:Casp8ap2 UTSW 4 32640554 missense probably damaging 0.99
R6014:Casp8ap2 UTSW 4 32641400 missense probably damaging 0.97
R6092:Casp8ap2 UTSW 4 32639380 missense probably damaging 1.00
R6257:Casp8ap2 UTSW 4 32641364 missense possibly damaging 0.94
R6289:Casp8ap2 UTSW 4 32639590 missense probably damaging 1.00
R6482:Casp8ap2 UTSW 4 32634813 missense probably damaging 1.00
R6496:Casp8ap2 UTSW 4 32641553 missense probably benign 0.05
R6515:Casp8ap2 UTSW 4 32646423 missense possibly damaging 0.64
R7015:Casp8ap2 UTSW 4 32644278 missense probably damaging 1.00
R7033:Casp8ap2 UTSW 4 32639392 missense probably damaging 1.00
R7072:Casp8ap2 UTSW 4 32644766 missense probably damaging 1.00
V7580:Casp8ap2 UTSW 4 32639944 missense probably benign 0.00
X0018:Casp8ap2 UTSW 4 32643738 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAGAGAACCCAACATTCAAATTGTC -3'
(R):5'- CAGCAGCTGTTTCTCTGGAG -3'

Sequencing Primer
(F):5'- TCACTGGGATGTGAAAAATCTGAAG -3'
(R):5'- GGAGTCTTTAATTCCCACTCTGC -3'
Posted On2014-09-18