Incidental Mutation 'R2104:Cdk6'
ID230770
Institutional Source Beutler Lab
Gene Symbol Cdk6
Ensembl Gene ENSMUSG00000040274
Gene Namecyclin-dependent kinase 6
SynonymsCrk2
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location3341485-3531008 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3344387 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 7 (S7R)
Ref Sequence ENSEMBL: ENSMUSP00000142796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042410] [ENSMUST00000165117] [ENSMUST00000197385] [ENSMUST00000197607] [ENSMUST00000199156]
Predicted Effect probably benign
Transcript: ENSMUST00000042410
AA Change: S7R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037925
Gene: ENSMUSG00000040274
AA Change: S7R

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165117
AA Change: S7R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126024
Gene: ENSMUSG00000040274
AA Change: S7R

DomainStartEndE-ValueType
S_TKc 13 300 4.26e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197385
AA Change: S7R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000143492
Gene: ENSMUSG00000040274
AA Change: S7R

DomainStartEndE-ValueType
Pfam:Pkinase 13 82 2.4e-11 PFAM
Pfam:Pkinase_Tyr 13 82 1.3e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197607
AA Change: S7R

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000199156
AA Change: S7R

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a member of the cyclin dependent kinase family of proteins that play important roles in the progression and regulation of the cell cycle. The encoded protein binds to a D-type cyclin to form an active kinase complex to regulate progression through the G1 phase of the cell cycle. Mice lacking the encoded protein exhibit thymic and splenic hypoplasia, and hematopoietic defects such as reduced number of megakaryocytes and erythrocytes. A pseudogene of this gene has been defined on chromosome 4. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display hematopoietic abnormalities affecting spleen and thymus size. Female body weight and fertility are also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Cdk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Cdk6 UTSW 5 3344211 start gained probably benign
R0583:Cdk6 UTSW 5 3473183 missense probably damaging 0.99
R1474:Cdk6 UTSW 5 3473217 missense probably benign 0.23
R1538:Cdk6 UTSW 5 3520675 missense probably benign 0.02
R3029:Cdk6 UTSW 5 3390817 critical splice donor site probably null
R4886:Cdk6 UTSW 5 3344444 missense possibly damaging 0.82
R4939:Cdk6 UTSW 5 3344377 missense probably null 0.99
R5421:Cdk6 UTSW 5 3473120 missense probably damaging 1.00
R5583:Cdk6 UTSW 5 3344436 missense probably damaging 1.00
R6247:Cdk6 UTSW 5 3344553 unclassified probably null
R7014:Cdk6 UTSW 5 3473152 missense probably damaging 1.00
R7102:Cdk6 UTSW 5 3520709 missense probably damaging 1.00
R7288:Cdk6 UTSW 5 3429001 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTATGTAATCGCTGCGGAG -3'
(R):5'- ACTCTTAACTTTAGTTGGGCCACC -3'

Sequencing Primer
(F):5'- CTCGGCTAGGCGGAGTTTC -3'
(R):5'- AAGGTCTCCAGGTGCCTCAG -3'
Posted On2014-09-18