Incidental Mutation 'R2104:Ube3a'
ID230786
Institutional Source Beutler Lab
Gene Symbol Ube3a
Ensembl Gene ENSMUSG00000025326
Gene Nameubiquitin protein ligase E3A
SynonymsHpve6a, 5830462N02Rik, E6-AP ubiquitin protein ligase, A130086L21Rik
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.468) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location59228750-59311536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59276477 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 334 (N334K)
Ref Sequence ENSEMBL: ENSMUSP00000143962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107537] [ENSMUST00000200709] [ENSMUST00000200758] [ENSMUST00000201409] [ENSMUST00000202440] [ENSMUST00000202945] [ENSMUST00000207686] [ENSMUST00000208313]
Predicted Effect possibly damaging
Transcript: ENSMUST00000107537
AA Change: N334K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103161
Gene: ENSMUSG00000025326
AA Change: N334K

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200709
Predicted Effect probably benign
Transcript: ENSMUST00000200758
AA Change: N355K

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143859
Gene: ENSMUSG00000025326
AA Change: N355K

DomainStartEndE-ValueType
Pfam:AZUL 27 81 1.7e-21 PFAM
Blast:HECTc 108 169 2e-20 BLAST
low complexity region 170 207 N/A INTRINSIC
Blast:HECTc 359 480 1e-12 BLAST
HECTc 540 870 5.05e-180 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200949
Predicted Effect probably benign
Transcript: ENSMUST00000201409
SMART Domains Protein: ENSMUSP00000144220
Gene: ENSMUSG00000025326

DomainStartEndE-ValueType
Pfam:AZUL 27 81 3.4e-18 PFAM
Blast:HECTc 108 169 5e-22 BLAST
low complexity region 170 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202207
Predicted Effect probably benign
Transcript: ENSMUST00000202440
SMART Domains Protein: ENSMUSP00000143896
Gene: ENSMUSG00000025326

DomainStartEndE-ValueType
Pfam:AZUL 6 50 1.4e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000202945
AA Change: N334K

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143962
Gene: ENSMUSG00000025326
AA Change: N334K

DomainStartEndE-ValueType
Pfam:AZUL 6 60 4.4e-21 PFAM
Blast:HECTc 87 148 2e-20 BLAST
low complexity region 149 186 N/A INTRINSIC
Blast:HECTc 338 459 1e-12 BLAST
HECTc 519 762 7.07e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207686
Predicted Effect probably benign
Transcript: ENSMUST00000208313
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase, part of the ubiquitin protein degradation system. This imprinted gene is maternally expressed in brain and biallelically expressed in other tissues. Maternally inherited deletion of this gene causes Angelman Syndrome, characterized by severe motor and intellectual retardation, ataxia, hypotonia, epilepsy, absence of speech, and characteristic facies. The protein also interacts with the E6 protein of human papillomavirus types 16 and 18, resulting in ubiquitination and proteolysis of tumor protein p53. Alternative splicing of this gene results in three transcript variants encoding three isoforms with different N-termini. Additional transcript variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with maternally inherited targeted null mutations exhibit reduced brain weight, impaired motor function, inducible seizures, learning deficits, abnormal hippocampal electroencephalographic recordings, and severely impaired long-term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Ube3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Ube3a APN 7 59272110 missense probably damaging 1.00
IGL00886:Ube3a APN 7 59284737 missense probably damaging 1.00
IGL02037:Ube3a APN 7 59275758 unclassified probably benign
IGL02127:Ube3a APN 7 59276041 missense probably benign 0.03
IGL02228:Ube3a APN 7 59288396 splice site probably benign
IGL02533:Ube3a APN 7 59304832 missense probably damaging 1.00
IGL02706:Ube3a APN 7 59272133 missense possibly damaging 0.67
IGL03037:Ube3a APN 7 59247223 splice site probably benign
IGL03213:Ube3a APN 7 59286122 nonsense probably null
IGL03306:Ube3a APN 7 59286147 missense probably damaging 1.00
Shawarma UTSW 7 59276183 nonsense probably null
PIT4362001:Ube3a UTSW 7 59276122 missense possibly damaging 0.86
R0847:Ube3a UTSW 7 59276586 missense possibly damaging 0.80
R1765:Ube3a UTSW 7 59286114 missense probably damaging 1.00
R1771:Ube3a UTSW 7 59275966 missense probably damaging 1.00
R1926:Ube3a UTSW 7 59276379 missense probably damaging 1.00
R1992:Ube3a UTSW 7 59303787 missense probably damaging 1.00
R2026:Ube3a UTSW 7 59303726 missense probably damaging 1.00
R3176:Ube3a UTSW 7 59276519 nonsense probably null
R3276:Ube3a UTSW 7 59276519 nonsense probably null
R3623:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3624:Ube3a UTSW 7 59272112 missense probably damaging 1.00
R3690:Ube3a UTSW 7 59276799 missense probably damaging 1.00
R4423:Ube3a UTSW 7 59276113 missense probably benign 0.10
R4583:Ube3a UTSW 7 59286063 missense probably damaging 1.00
R4883:Ube3a UTSW 7 59243450 start codon destroyed probably benign 0.21
R4992:Ube3a UTSW 7 59284820 missense possibly damaging 0.47
R5175:Ube3a UTSW 7 59288717 missense probably damaging 1.00
R5397:Ube3a UTSW 7 59286912 missense probably benign 0.26
R5545:Ube3a UTSW 7 59272024 missense probably damaging 1.00
R5572:Ube3a UTSW 7 59288777 missense probably damaging 1.00
R5635:Ube3a UTSW 7 59288488 missense probably damaging 1.00
R5766:Ube3a UTSW 7 59276059 missense possibly damaging 0.89
R5890:Ube3a UTSW 7 59272028 missense probably damaging 1.00
R5956:Ube3a UTSW 7 59277020 unclassified probably benign
R6388:Ube3a UTSW 7 59304921 unclassified probably null
R6464:Ube3a UTSW 7 59276183 nonsense probably null
R6467:Ube3a UTSW 7 59276902 missense probably damaging 1.00
R6474:Ube3a UTSW 7 59287024 missense probably damaging 1.00
R6669:Ube3a UTSW 7 59276857 missense probably benign 0.02
R7003:Ube3a UTSW 7 59276440 missense probably damaging 1.00
R7044:Ube3a UTSW 7 59288413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAATATCTGGAAATGGCG -3'
(R):5'- GTTCGGTTTCTAGTGGATCCAC -3'

Sequencing Primer
(F):5'- GCGTTGCCATTATTTTGCAAAGC -3'
(R):5'- GTGGATCCACTCGAGGACCTTTC -3'
Posted On2014-09-18