Incidental Mutation 'R0179:Pcdhb5'
ID23079
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 038447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0179 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37322559 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 664 (G664D)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably damaging
Transcript: ENSMUST00000078271
AA Change: G664D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: G664D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,214 S516P probably benign Het
4932431P20Rik A G 7: 29,535,940 noncoding transcript Het
Adamts1 C T 16: 85,795,465 S948N probably benign Het
Adck1 A T 12: 88,459,172 M457L possibly damaging Het
Adprm A T 11: 67,038,225 H313Q possibly damaging Het
Adssl1 T C 12: 112,632,269 I104T probably benign Het
Agxt2 A C 15: 10,399,048 Q435P possibly damaging Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Ankrd50 A G 3: 38,455,314 V968A possibly damaging Het
Brf2 T C 8: 27,125,868 D163G possibly damaging Het
Cd226 C A 18: 89,207,139 N53K probably benign Het
Cdc42ep2 T C 19: 5,918,608 D23G probably benign Het
Cdc7 T C 5: 106,965,039 S8P probably benign Het
Cdh8 C T 8: 99,111,712 E499K possibly damaging Het
Chd7 T A 4: 8,862,516 F2534L probably benign Het
Ckb T C 12: 111,670,176 T255A probably benign Het
Cntnap5c G T 17: 57,769,625 W19L probably benign Het
Cntrl A G 2: 35,167,859 E1854G probably benign Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cop1 A G 1: 159,250,066 D157G probably benign Het
Csf2rb A C 15: 78,336,372 Q38P possibly damaging Het
Ctla2b T C 13: 60,896,293 D52G possibly damaging Het
Dcaf7 A T 11: 106,051,797 D190V probably damaging Het
Depdc5 T A 5: 32,901,574 probably benign Het
Dgkq A G 5: 108,658,200 probably benign Het
Dhrs2 A G 14: 55,240,476 T222A probably damaging Het
Dock1 G A 7: 135,098,837 D1109N probably damaging Het
E4f1 G C 17: 24,451,437 T92S possibly damaging Het
Ep400 A T 5: 110,668,649 S2669T probably damaging Het
Eprs T G 1: 185,413,547 D1184E probably benign Het
Fpr-rs4 A T 17: 18,022,027 K99* probably null Het
Fzr1 A T 10: 81,369,070 probably benign Het
Gcc2 C T 10: 58,276,650 R1001C probably benign Het
Gm4884 A G 7: 41,043,828 D407G probably benign Het
Golga4 A T 9: 118,560,740 probably null Het
Gp2 T G 7: 119,452,317 D225A possibly damaging Het
Gramd1a T A 7: 31,142,418 T120S probably damaging Het
Hbb-bh2 T A 7: 103,839,227 N121I probably benign Het
Htr6 A T 4: 139,062,126 L276Q probably damaging Het
Itga9 A T 9: 118,661,386 I262F probably benign Het
Lamc3 A G 2: 31,915,084 probably benign Het
Large1 T C 8: 73,098,846 N200S probably benign Het
Lct C T 1: 128,327,685 V207I probably benign Het
Marf1 C A 16: 14,151,176 L144F probably damaging Het
Morc2b A T 17: 33,136,982 Y605* probably null Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Muc2 A G 7: 141,748,971 Y17C probably damaging Het
Myf5 T C 10: 107,485,918 D5G possibly damaging Het
Nasp C T 4: 116,602,157 V375M probably damaging Het
Nr1h2 A T 7: 44,552,265 probably null Het
Nrg2 T C 18: 36,022,415 Q447R probably benign Het
Ntn5 G A 7: 45,686,313 G56D probably damaging Het
Oasl2 A G 5: 114,910,912 R138G probably benign Het
Olfr1209 A T 2: 88,909,893 C167S possibly damaging Het
Olfr1489 T A 19: 13,633,140 F10I probably damaging Het
Olfr827 T C 10: 130,210,338 Y264C probably damaging Het
Ppp1r15a T C 7: 45,525,000 E128G probably damaging Het
Prpf19 T C 19: 10,897,808 probably benign Het
Ptpn3 T A 4: 57,270,118 T15S probably benign Het
R3hdm2 G A 10: 127,495,106 C818Y probably damaging Het
Rad51d A G 11: 82,889,998 V39A possibly damaging Het
Rptor A T 11: 119,872,367 T926S probably benign Het
Rwdd4a G A 8: 47,542,707 D41N probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Ssbp3 T C 4: 107,046,388 S334P probably damaging Het
Suco A G 1: 161,876,305 probably benign Het
Synj1 T C 16: 90,964,631 K649R possibly damaging Het
Tdp2 C T 13: 24,840,448 H243Y possibly damaging Het
Tinag A G 9: 76,996,882 probably benign Het
Trerf1 T C 17: 47,316,662 noncoding transcript Het
Trip10 T C 17: 57,262,349 probably benign Het
Tsen54 A T 11: 115,822,030 S131C probably damaging Het
Unc5c A T 3: 141,818,067 R794* probably null Het
Vmn2r59 A T 7: 42,047,008 Y103* probably null Het
Washc5 A G 15: 59,352,530 V460A probably benign Het
Whamm A G 7: 81,594,015 T358A probably benign Het
Xlr4b C T X: 73,218,671 probably benign Het
Zbbx C T 3: 75,085,562 probably benign Het
Zdhhc23 G A 16: 43,973,703 P203S probably benign Het
Zfp27 T A 7: 29,896,425 E38D possibly damaging Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 intron probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1617:Pcdhb5 UTSW 18 37321402 nonsense probably null
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCTAGACGACAATGACAATGCGCC -3'
(R):5'- TGAACTCACCAGTCCCAGATTCTCC -3'

Sequencing Primer
(F):5'- CTGGATACCTGGTCACCAAG -3'
(R):5'- CCTGTTAGACACATGTCATACTGG -3'
Posted On2013-04-16