Incidental Mutation 'R2104:Foxc2'
ID230794
Institutional Source Beutler Lab
Gene Symbol Foxc2
Ensembl Gene ENSMUSG00000046714
Gene Nameforkhead box C2
SynonymsMfh1, Fkh14, MFH-1, Hfhbf3
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2104 (G1)
Quality Score124
Status Validated
Chromosome8
Chromosomal Location121116171-121118895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121118080 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 489 (Y489C)
Ref Sequence ENSEMBL: ENSMUSP00000055290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054691] [ENSMUST00000127664]
Predicted Effect probably damaging
Transcript: ENSMUST00000054691
AA Change: Y489C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055290
Gene: ENSMUSG00000046714
AA Change: Y489C

DomainStartEndE-ValueType
FH 69 159 2.11e-63 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
low complexity region 288 312 N/A INTRINSIC
low complexity region 379 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die perinatally or before with cardiac abnormalities and skeletal defects in the neurocranium and spine. Heterozygotes exhibit lymphatic vessel and lymph node hyperplasia, anterior segment defects, and distichiasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Foxc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02612:Foxc2 APN 8 121117837 missense probably benign 0.10
IGL02973:Foxc2 APN 8 121118049 missense probably benign
R0211:Foxc2 UTSW 8 121116616 start codon destroyed probably null 0.77
R0477:Foxc2 UTSW 8 121118035 missense probably damaging 0.99
R1589:Foxc2 UTSW 8 121117176 missense probably benign
R1859:Foxc2 UTSW 8 121116625 missense probably damaging 0.98
R1965:Foxc2 UTSW 8 121116674 missense probably damaging 0.99
R4274:Foxc2 UTSW 8 121117700 missense probably benign 0.30
R4392:Foxc2 UTSW 8 121117452 missense probably damaging 0.98
Z1088:Foxc2 UTSW 8 121116959 missense possibly damaging 0.95
Z1088:Foxc2 UTSW 8 121117150 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTCCTGGTATCTGAACCAC -3'
(R):5'- CAAACTGAGCTGCGGATAAGTTAC -3'

Sequencing Primer
(F):5'- TGGTATCTGAACCACGGCGG -3'
(R):5'- CTGCGGATAAGTTACCTGCGAG -3'
Posted On2014-09-18