Incidental Mutation 'R2104:Zfp523'
ID230828
Institutional Source Beutler Lab
Gene Symbol Zfp523
Ensembl Gene ENSMUSG00000024220
Gene Namezinc finger protein 523
Synonyms
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.489) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28177207-28205886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28195216 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 75 (T75S)
Ref Sequence ENSEMBL: ENSMUSP00000073226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002318] [ENSMUST00000073534] [ENSMUST00000133868]
Predicted Effect probably benign
Transcript: ENSMUST00000002318
AA Change: T75S

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000002318
Gene: ENSMUSG00000024220
AA Change: T75S

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073534
AA Change: T75S

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073226
Gene: ENSMUSG00000024220
AA Change: T75S

DomainStartEndE-ValueType
internal_repeat_1 7 45 7.42e-6 PROSPERO
internal_repeat_1 60 99 7.42e-6 PROSPERO
low complexity region 116 129 N/A INTRINSIC
ZnF_C2H2 165 189 7.15e-2 SMART
ZnF_C2H2 195 219 3.16e-3 SMART
ZnF_C2H2 225 249 8.47e-4 SMART
ZnF_C2H2 255 279 2.24e-3 SMART
ZnF_C2H2 285 309 3.44e-4 SMART
ZnF_C2H2 315 339 1.69e-3 SMART
ZnF_C2H2 345 368 5.06e-2 SMART
low complexity region 375 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133868
SMART Domains Protein: ENSMUSP00000123127
Gene: ENSMUSG00000024220

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
ZnF_C2H2 84 108 7.15e-2 SMART
ZnF_C2H2 114 138 3.16e-3 SMART
ZnF_C2H2 144 168 8.47e-4 SMART
ZnF_C2H2 174 198 3.44e-4 SMART
ZnF_C2H2 204 228 1.69e-3 SMART
ZnF_C2H2 234 257 5.06e-2 SMART
low complexity region 264 285 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161275
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Slit1 T C 19: 41,602,247 K1329E possibly damaging Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Other mutations in Zfp523
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Zfp523 APN 17 28201049 missense possibly damaging 0.95
IGL01405:Zfp523 APN 17 28204506 missense probably damaging 0.99
IGL02430:Zfp523 APN 17 28195139 unclassified probably benign
R0496:Zfp523 UTSW 17 28200445 missense possibly damaging 0.83
R1533:Zfp523 UTSW 17 28204499 missense probably benign 0.18
R1837:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1838:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R1839:Zfp523 UTSW 17 28194993 missense probably damaging 0.99
R2023:Zfp523 UTSW 17 28201004 unclassified probably benign
R2403:Zfp523 UTSW 17 28195209 missense probably damaging 1.00
R2864:Zfp523 UTSW 17 28202540 missense probably benign 0.00
R4157:Zfp523 UTSW 17 28202283 missense probably benign 0.06
R4214:Zfp523 UTSW 17 28201029 missense probably benign 0.04
R4771:Zfp523 UTSW 17 28201338 splice site probably null
R5869:Zfp523 UTSW 17 28194993 missense probably benign 0.37
R5950:Zfp523 UTSW 17 28202558 missense probably benign 0.06
R6443:Zfp523 UTSW 17 28201407 missense probably damaging 0.99
R6679:Zfp523 UTSW 17 28202220 missense probably damaging 1.00
R6694:Zfp523 UTSW 17 28200472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTACATTCACCAGGTGACGATAC -3'
(R):5'- TGGTGTGACAAGGTACCAGC -3'

Sequencing Primer
(F):5'- CATTCACCAGGTGACGATACAGAAAG -3'
(R):5'- AGGTACCAGCGCCTACAG -3'
Posted On2014-09-18