Incidental Mutation 'R2104:Slit1'
ID230831
Institutional Source Beutler Lab
Gene Symbol Slit1
Ensembl Gene ENSMUSG00000025020
Gene Nameslit guidance ligand 1
SynonymsSlil1
MMRRC Submission 040108-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2104 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41600257-41743665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41602247 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1329 (K1329E)
Ref Sequence ENSEMBL: ENSMUSP00000129034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025993] [ENSMUST00000166496] [ENSMUST00000169141]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025993
AA Change: K1329E

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025993
Gene: ENSMUSG00000025020
AA Change: K1329E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
CT 1462 1531 3.15e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166496
AA Change: K1329E

PolyPhen 2 Score 0.549 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128381
Gene: ENSMUSG00000025020
AA Change: K1329E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
low complexity region 1437 1458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169141
AA Change: K1329E

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129034
Gene: ENSMUSG00000025020
AA Change: K1329E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LRRNT 33 65 5.68e-9 SMART
LRR 59 83 4.58e1 SMART
LRR 84 107 4.7e0 SMART
LRR_TYP 108 131 1.95e-3 SMART
LRR 133 155 6.05e0 SMART
LRR 157 179 3.98e1 SMART
LRR_TYP 180 203 3.44e-4 SMART
LRRCT 215 264 3.51e-6 SMART
LRRNT 281 313 3e-8 SMART
LRR 307 331 6.41e1 SMART
LRR_TYP 332 355 8.22e-2 SMART
LRR_TYP 356 379 9.08e-4 SMART
LRR 380 403 2.82e0 SMART
LRR_TYP 404 427 5.42e-2 SMART
LRRCT 439 488 5.78e-7 SMART
LRRNT 512 544 1.04e-7 SMART
LRR_TYP 564 587 3.39e-3 SMART
LRR 589 611 2.08e1 SMART
LRR_TYP 612 635 1.56e-2 SMART
LRR_TYP 636 659 4.11e-2 SMART
LRRCT 671 720 2.89e-7 SMART
LRRNT 733 765 4.87e-8 SMART
LRR 783 806 1.22e1 SMART
LRR_TYP 807 830 9.73e-4 SMART
LRR_TYP 831 854 9.58e-3 SMART
LRRCT 866 915 5.6e-14 SMART
EGF 928 962 5.08e-7 SMART
EGF 967 1003 1.74e-5 SMART
EGF_CA 1005 1041 1.05e-8 SMART
EGF 1046 1081 1.21e-4 SMART
EGF_CA 1083 1119 3.64e-8 SMART
FOLN 1086 1108 8.44e0 SMART
FOLN 1127 1149 1.4e0 SMART
EGF 1127 1160 1.78e-2 SMART
LamG 1183 1319 4.43e-38 SMART
EGF 1338 1371 6.76e-3 SMART
EGF 1377 1410 3.38e-3 SMART
FOLN 1418 1440 2.25e1 SMART
EGF 1418 1451 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169416
Meta Mutation Damage Score 0.024 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal interneuron numbers and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm3 G A 7: 119,784,304 V563I probably benign Het
Amer3 T C 1: 34,588,678 V666A probably benign Het
Ankrd16 A G 2: 11,779,900 probably benign Het
Ankub1 G T 3: 57,672,875 C120* probably null Het
Arhgap31 T C 16: 38,625,579 I135V probably benign Het
Atp2c2 G A 8: 119,749,845 G633D probably benign Het
Camta1 T A 4: 151,453,294 Q143L probably damaging Het
Casp8ap2 T C 4: 32,644,727 S1267P probably benign Het
Ccdc109b T A 3: 129,918,688 R179S probably benign Het
Cdh1 T A 8: 106,653,759 probably benign Het
Cdhr4 C A 9: 107,996,261 D397E probably damaging Het
Cdk6 T G 5: 3,344,387 S7R probably benign Het
Cilp2 C A 8: 69,882,792 E519* probably null Het
Clybl A G 14: 122,311,306 Y40C probably damaging Het
Col4a3bp T A 13: 96,634,886 N550K probably damaging Het
Ctnnal1 T C 4: 56,812,329 *732W probably null Het
Ctns A T 11: 73,193,081 S38R probably benign Het
Cwh43 A T 5: 73,421,530 K293N possibly damaging Het
Dcaf5 G T 12: 80,338,861 D830E probably benign Het
Dmxl2 A G 9: 54,415,564 V1512A probably damaging Het
Dnah9 A T 11: 66,061,124 C1850S probably damaging Het
Dpp8 C T 9: 65,074,567 probably null Het
Enam A T 5: 88,501,787 Q385L probably damaging Het
Etv3 A G 3: 87,536,062 T318A possibly damaging Het
Exd2 T G 12: 80,496,801 I586S probably benign Het
Fat3 A G 9: 15,998,517 V2063A possibly damaging Het
Fezf1 A G 6: 23,247,332 F248S possibly damaging Het
Flnc T C 6: 29,450,735 probably null Het
Foxc2 A G 8: 121,118,080 Y489C probably damaging Het
Gfm2 A G 13: 97,171,520 E540G probably damaging Het
Hrg T C 16: 22,956,199 I193T probably benign Het
Ifih1 G A 2: 62,610,545 Q426* probably null Het
Ifit1bl2 T A 19: 34,619,520 D232V probably benign Het
Igf2bp1 A G 11: 95,975,296 V122A probably damaging Het
Inpp1 T G 1: 52,799,418 Q24P probably damaging Het
Kifc2 A G 15: 76,661,254 D67G probably damaging Het
Lrrc43 G A 5: 123,501,114 G402D probably benign Het
Lrrc8c C T 5: 105,607,358 T333M possibly damaging Het
Mab21l3 G T 3: 101,823,428 A165D probably benign Het
Mdfi G C 17: 47,824,637 A56G possibly damaging Het
Mdn1 A T 4: 32,743,843 probably null Het
Meox2 A G 12: 37,167,477 T226A probably damaging Het
Mipol1 A G 12: 57,306,056 probably null Het
Mms22l T G 4: 24,591,084 N1018K probably benign Het
Mn1 T C 5: 111,454,751 I1285T possibly damaging Het
Muc20 T G 16: 32,794,177 S277R probably damaging Het
Muc6 C A 7: 141,634,078 V2845L probably benign Het
Mup5 C A 4: 61,833,725 G96C probably damaging Het
Neb T A 2: 52,256,814 M2813L probably benign Het
Neb C A 2: 52,271,558 R2074L probably damaging Het
Oasl2 A T 5: 114,911,002 K168* probably null Het
Olfr774 T C 10: 129,238,499 S117P probably damaging Het
P2rx2 C T 5: 110,341,141 D203N probably damaging Het
Ptprg T C 14: 11,952,897 probably null Het
Rims4 C T 2: 163,864,865 probably null Het
Rtn4ip1 T A 10: 43,932,406 W60R probably benign Het
Sccpdh T C 1: 179,670,597 S69P probably benign Het
Serpina3b T A 12: 104,138,810 I415N probably benign Het
Slc22a4 T C 11: 53,983,610 probably benign Het
Slc4a5 G A 6: 83,297,378 A1076T probably benign Het
Synj2bp A C 12: 81,502,052 F138V probably benign Het
Taar7a T C 10: 23,993,061 I141V probably damaging Het
Tas1r3 T C 4: 155,862,131 E339G probably benign Het
Tep1 A G 14: 50,850,580 probably benign Het
Tgds A T 14: 118,121,737 Y146* probably null Het
Tgm3 G A 2: 130,037,483 V332I probably benign Het
Tnnt2 A G 1: 135,843,809 probably benign Het
Top1 T A 2: 160,704,819 Y340N probably damaging Het
Topbp1 T C 9: 103,317,982 probably benign Het
Tpst1 A G 5: 130,102,361 N224S probably benign Het
Traf4 A G 11: 78,160,014 F439L probably damaging Het
Trim58 A G 11: 58,643,138 probably benign Het
Tspan31 T C 10: 127,068,135 N205S probably damaging Het
Ube3a T A 7: 59,276,477 N334K possibly damaging Het
Ugt2a3 A T 5: 87,329,682 probably null Het
Vwf G A 6: 125,646,330 V1797I probably benign Het
Wdr81 G T 11: 75,452,983 P486Q probably damaging Het
Whamm C T 7: 81,591,771 R277* probably null Het
Wisp1 A G 15: 66,919,327 E326G probably benign Het
Yipf7 T A 5: 69,521,119 N56I possibly damaging Het
Zfp523 A T 17: 28,195,216 T75S probably benign Het
Other mutations in Slit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Slit1 APN 19 41650835 missense probably damaging 1.00
IGL00515:Slit1 APN 19 41624501 missense probably damaging 0.97
IGL00909:Slit1 APN 19 41602255 missense possibly damaging 0.89
IGL00953:Slit1 APN 19 41602300 missense probably damaging 1.00
IGL01116:Slit1 APN 19 41606385 missense possibly damaging 0.93
IGL01457:Slit1 APN 19 41611044 missense probably damaging 1.00
IGL01688:Slit1 APN 19 41729106 missense probably damaging 1.00
IGL01720:Slit1 APN 19 41634214 missense probably benign 0.01
IGL01925:Slit1 APN 19 41608378 missense probably damaging 0.98
IGL02008:Slit1 APN 19 41646140 missense probably damaging 0.99
IGL02312:Slit1 APN 19 41601680 missense possibly damaging 0.66
IGL02398:Slit1 APN 19 41602237 missense probably damaging 1.00
IGL02542:Slit1 APN 19 41627248 missense probably damaging 1.00
IGL02559:Slit1 APN 19 41721085 missense probably benign 0.01
IGL02609:Slit1 APN 19 41602304 missense probably damaging 0.99
IGL02623:Slit1 APN 19 41651683 missense probably damaging 0.98
IGL02729:Slit1 APN 19 41603334 missense probably damaging 1.00
IGL03230:Slit1 APN 19 41729085 missense probably damaging 1.00
IGL03387:Slit1 APN 19 41603442 missense possibly damaging 0.57
PIT4576001:Slit1 UTSW 19 41624549 missense possibly damaging 0.52
R0366:Slit1 UTSW 19 41611031 missense probably damaging 1.00
R0432:Slit1 UTSW 19 41743293 missense probably damaging 0.98
R0496:Slit1 UTSW 19 41608311 splice site probably benign
R0722:Slit1 UTSW 19 41608435 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1468:Slit1 UTSW 19 41608384 missense probably damaging 1.00
R1488:Slit1 UTSW 19 41608385 missense probably damaging 1.00
R1615:Slit1 UTSW 19 41650671 splice site probably benign
R1694:Slit1 UTSW 19 41637592 missense possibly damaging 0.69
R1762:Slit1 UTSW 19 41603335 missense probably damaging 1.00
R1842:Slit1 UTSW 19 41721038 critical splice donor site probably null
R1844:Slit1 UTSW 19 41625573 missense probably damaging 1.00
R1940:Slit1 UTSW 19 41630776 missense probably damaging 1.00
R2087:Slit1 UTSW 19 41637483 missense probably benign 0.00
R2094:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2095:Slit1 UTSW 19 41606380 missense probably damaging 0.99
R2305:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2972:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2973:Slit1 UTSW 19 41611016 missense probably benign 0.03
R2974:Slit1 UTSW 19 41611016 missense probably benign 0.03
R3159:Slit1 UTSW 19 41604373 missense probably benign
R3752:Slit1 UTSW 19 41646967 critical splice donor site probably null
R4095:Slit1 UTSW 19 41608486 intron probably benign
R4282:Slit1 UTSW 19 41614417 missense probably benign
R4417:Slit1 UTSW 19 41614469 missense probably damaging 1.00
R4607:Slit1 UTSW 19 41616793 missense probably benign 0.10
R4729:Slit1 UTSW 19 41647020 missense probably damaging 1.00
R4756:Slit1 UTSW 19 41649013 missense probably damaging 1.00
R4764:Slit1 UTSW 19 41721044 nonsense probably null
R4849:Slit1 UTSW 19 41649544 missense probably benign 0.17
R4874:Slit1 UTSW 19 41729054 critical splice donor site probably null
R5581:Slit1 UTSW 19 41616663 critical splice donor site probably null
R5699:Slit1 UTSW 19 41625520 critical splice donor site probably null
R5888:Slit1 UTSW 19 41743296 missense probably damaging 1.00
R5906:Slit1 UTSW 19 41606374 missense probably damaging 1.00
R6176:Slit1 UTSW 19 41637595 missense probably damaging 1.00
R6277:Slit1 UTSW 19 41600509 missense possibly damaging 0.81
R6702:Slit1 UTSW 19 41614870 missense possibly damaging 0.95
R6860:Slit1 UTSW 19 41616715 missense probably benign 0.10
R7015:Slit1 UTSW 19 41629886 nonsense probably null
R7172:Slit1 UTSW 19 41634666 missense probably damaging 1.00
X0023:Slit1 UTSW 19 41601640 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATAAGTAAGTGGGGCTTGC -3'
(R):5'- ATGTCCTAGTCCCAACTTAGCC -3'

Sequencing Primer
(F):5'- GGATGGCTCTCTTGGTCCATC -3'
(R):5'- AGTCCCAACTTAGCCTACTATTTC -3'
Posted On2014-09-18