Incidental Mutation 'R2105:Mfn2'
ID230855
Institutional Source Beutler Lab
Gene Symbol Mfn2
Ensembl Gene ENSMUSG00000029020
Gene Namemitofusin 2
Synonymshypertension related protein 1, D630023P19Rik, Fzo
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location147873599-147904704 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 147888705 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 172 (Q172*)
Ref Sequence ENSEMBL: ENSMUSP00000123021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030884] [ENSMUST00000105714] [ENSMUST00000105715] [ENSMUST00000105716] [ENSMUST00000134172]
Predicted Effect probably null
Transcript: ENSMUST00000030884
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000030884
Gene: ENSMUSG00000029020
AA Change: Q172*

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 3.8e-6 PFAM
Pfam:Dynamin_N 99 259 2e-24 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 594 754 1.6e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105714
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000101339
Gene: ENSMUSG00000029020
AA Change: Q172*

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 6.1e-7 PFAM
Pfam:Dynamin_N 99 259 3.6e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105715
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000101340
Gene: ENSMUSG00000029020
AA Change: Q172*

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105716
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000101341
Gene: ENSMUSG00000029020
AA Change: Q172*

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124646
Predicted Effect probably null
Transcript: ENSMUST00000134172
AA Change: Q172*
SMART Domains Protein: ENSMUSP00000123021
Gene: ENSMUSG00000029020
AA Change: Q172*

DomainStartEndE-ValueType
Pfam:Dynamin_N 99 208 5.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid-gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Itgam T A 7: 128,081,712 V271D probably damaging Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Mfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Mfn2 APN 4 147885490 missense probably damaging 1.00
IGL03236:Mfn2 APN 4 147882105 missense probably damaging 1.00
milkshake UTSW 4 147887452 missense probably benign 0.12
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0326:Mfn2 UTSW 4 147883288 missense probably damaging 1.00
R0376:Mfn2 UTSW 4 147885526 missense probably benign 0.24
R0564:Mfn2 UTSW 4 147883255 missense probably damaging 1.00
R0962:Mfn2 UTSW 4 147882201 missense probably benign
R1595:Mfn2 UTSW 4 147894696 missense probably benign 0.08
R2260:Mfn2 UTSW 4 147894606 nonsense probably null
R4544:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4546:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4561:Mfn2 UTSW 4 147877035 missense probably damaging 1.00
R5151:Mfn2 UTSW 4 147886328 missense probably benign 0.10
R5355:Mfn2 UTSW 4 147894578 missense probably damaging 1.00
R6645:Mfn2 UTSW 4 147894612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGAACTCTCGACCTG -3'
(R):5'- CTGATGCATGCAGTGAGAGA -3'

Sequencing Primer
(F):5'- CTGAATCACCCAGAAATGGAGACTTG -3'
(R):5'- ATCCCAGGCTGACAATAC -3'
Posted On2014-09-18