Incidental Mutation 'R2105:Itgam'
ID230875
Institutional Source Beutler Lab
Gene Symbol Itgam
Ensembl Gene ENSMUSG00000030786
Gene Nameintegrin alpha M
SynonymsMac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3
MMRRC Submission 040109-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R2105 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128062640-128118491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128081712 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 271 (V271D)
Ref Sequence ENSEMBL: ENSMUSP00000113957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]
Predicted Effect probably damaging
Transcript: ENSMUST00000064821
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098015
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106240
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106242
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120355
AA Change: V271D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: V271D

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C T 6: 121,673,500 P1189L probably benign Het
Acbd4 G A 11: 103,104,439 D57N probably damaging Het
Acot4 A T 12: 84,038,742 M78L probably damaging Het
Ago1 A T 4: 126,461,788 M76K probably benign Het
Agrn G T 4: 156,177,299 Y511* probably null Het
Arhgef15 A T 11: 68,947,681 probably null Het
Atp1a3 A T 7: 24,989,853 M594K probably damaging Het
Atp4a G A 7: 30,720,368 probably null Het
Bckdk T A 7: 127,907,317 I272N probably damaging Het
Bod1l A G 5: 41,832,279 V367A probably benign Het
C1galt1c1 T C X: 38,631,268 M284V possibly damaging Het
Cenpk T A 13: 104,229,597 C4* probably null Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chil3 T C 3: 106,160,478 I124V possibly damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Cyp2c67 T C 19: 39,626,237 Y282C probably benign Het
D5Ertd579e C T 5: 36,613,449 A1201T probably benign Het
Dock4 A G 12: 40,692,989 H381R probably benign Het
Drc1 C T 5: 30,356,441 S447F probably benign Het
Fam83g G T 11: 61,703,458 R606L probably benign Het
Fmnl1 A C 11: 103,194,692 S688R probably benign Het
Fryl C T 5: 73,122,299 V219I probably benign Het
Gm13101 A T 4: 143,965,820 Y204N probably benign Het
Golgb1 T A 16: 36,914,664 N1424K probably benign Het
Gpr39 T C 1: 125,677,884 V183A possibly damaging Het
H2-T22 A T 17: 36,040,517 Y274N probably benign Het
Hif1a T A 12: 73,937,745 Y313N probably damaging Het
Hip1r T A 5: 124,000,204 M787K probably damaging Het
Hipk3 T C 2: 104,439,392 E484G probably damaging Het
Hsh2d T A 8: 72,200,646 F291I probably benign Het
Ino80 T C 2: 119,431,929 E692G probably null Het
Kansl1 A C 11: 104,335,559 I924S probably damaging Het
Kcnq2 A G 2: 181,081,352 C628R probably benign Het
Krt78 A C 15: 101,947,414 V654G possibly damaging Het
Lrit2 A G 14: 37,071,956 T326A probably damaging Het
Ltk T C 2: 119,752,088 E710G probably damaging Het
Lysmd1 T C 3: 95,134,974 L53S probably damaging Het
Mc4r T C 18: 66,859,598 Y148C probably damaging Het
Mfn2 G A 4: 147,888,705 Q172* probably null Het
Mknk2 A G 10: 80,668,601 L242P possibly damaging Het
Mrpl45 A T 11: 97,325,747 H167L probably benign Het
Myc T C 15: 61,988,102 V208A probably damaging Het
Myh7b A G 2: 155,629,457 E1175G probably benign Het
Myo18a A T 11: 77,850,234 M1456L probably benign Het
Myocd G A 11: 65,218,658 Q96* probably null Het
Nckap5 T A 1: 126,026,518 I766F probably damaging Het
Ndst1 T C 18: 60,691,253 E784G probably benign Het
Nf1 A T 11: 79,469,826 R1443S possibly damaging Het
Nhlrc3 A G 3: 53,453,651 W228R probably damaging Het
Nup107 G A 10: 117,773,320 T378I probably damaging Het
Olfr1033 C T 2: 86,041,330 T5I probably damaging Het
Olfr1131 A G 2: 87,628,939 T159A probably benign Het
Olfr293 A T 7: 86,664,383 K240N probably damaging Het
Olfr524 T A 7: 140,202,743 D9V probably benign Het
Olfr607 T A 7: 103,460,273 probably null Het
Olfr98 A T 17: 37,263,073 M197K probably benign Het
Otop1 A G 5: 38,300,458 D520G probably benign Het
Papln C T 12: 83,780,236 P712S probably benign Het
Pcbd2 T A 13: 55,733,033 I34N probably damaging Het
Pkd1l3 T A 8: 109,647,573 C29* probably null Het
Pou5f1 G A 17: 35,510,002 V114M probably benign Het
Prpf4b C A 13: 34,884,231 probably benign Het
Prr23a1 C T 9: 98,842,656 P24S probably damaging Het
Ptch1 T A 13: 63,545,245 M65L probably benign Het
Rc3h2 A T 2: 37,399,624 I392K possibly damaging Het
Reck G T 4: 43,943,195 D916Y probably damaging Het
Rtf2 A G 2: 172,445,365 D68G probably damaging Het
Ryr1 G T 7: 29,090,150 T1513K probably damaging Het
Sacs A G 14: 61,173,441 D55G possibly damaging Het
Scn9a A G 2: 66,568,183 S28P probably benign Het
Scrn3 A G 2: 73,329,852 M280V probably damaging Het
Snx29 C T 16: 11,511,034 T559I possibly damaging Het
Spn C T 7: 127,136,241 E109K probably damaging Het
Sra1 C T 18: 36,675,068 R369H probably benign Het
Srsf11 C T 3: 158,019,345 A64T probably damaging Het
Stk17b A G 1: 53,776,605 S12P probably benign Het
Sult1d1 C A 5: 87,559,802 G153V probably damaging Het
Sycp2 A T 2: 178,350,138 probably null Het
Tgfb3 T C 12: 86,069,769 E165G possibly damaging Het
Tns2 C A 15: 102,107,506 H160N probably benign Het
Ubn1 T A 16: 5,077,224 C711* probably null Het
Usp13 A T 3: 32,901,986 D469V probably damaging Het
Vmn1r231 A T 17: 20,890,118 H178Q possibly damaging Het
Vwa1 A G 4: 155,772,793 S183P probably damaging Het
Xpo7 A G 14: 70,690,991 I424T probably benign Het
Zfp109 A G 7: 24,236,616 probably null Het
Other mutations in Itgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 128085661 missense probably damaging 1.00
IGL00983:Itgam APN 7 128068667 missense probably damaging 0.97
IGL01102:Itgam APN 7 128080273 missense possibly damaging 0.94
IGL01615:Itgam APN 7 128116767 missense possibly damaging 0.80
IGL01845:Itgam APN 7 128112472 missense probably damaging 1.00
IGL01860:Itgam APN 7 128070943 missense probably benign 0.03
IGL01874:Itgam APN 7 128115166 missense probably damaging 0.97
IGL01910:Itgam APN 7 128083776 missense probably damaging 1.00
IGL01994:Itgam APN 7 128101727 missense probably damaging 0.97
IGL02332:Itgam APN 7 128085674 critical splice donor site probably null
IGL02348:Itgam APN 7 128116300 missense possibly damaging 0.52
IGL02394:Itgam APN 7 128084942 missense probably benign 0.01
IGL02491:Itgam APN 7 128116018 missense possibly damaging 0.71
IGL02695:Itgam APN 7 128085941 missense possibly damaging 0.81
IGL02821:Itgam APN 7 128076109 missense probably damaging 0.99
IGL02970:Itgam APN 7 128086043 missense probably benign 0.00
IGL03145:Itgam APN 7 128113019 missense probably benign 0.12
apparition UTSW 7 128112286 splice site probably null
invisible UTSW 7 128070703 unclassified probably null
obscured UTSW 7 128081634 missense probably damaging 1.00
R0184:Itgam UTSW 7 128086058 missense probably damaging 0.96
R0389:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0443:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0454:Itgam UTSW 7 128107980 missense probably benign 0.01
R0674:Itgam UTSW 7 128116218 missense possibly damaging 0.67
R0828:Itgam UTSW 7 128116505 critical splice donor site probably null
R0925:Itgam UTSW 7 128112238 missense probably benign 0.00
R1086:Itgam UTSW 7 128080264 missense probably damaging 1.00
R1655:Itgam UTSW 7 128115163 missense probably benign 0.00
R1809:Itgam UTSW 7 128070937 missense possibly damaging 0.62
R1823:Itgam UTSW 7 128064732 missense probably benign 0.04
R2154:Itgam UTSW 7 128085577 missense probably damaging 0.99
R2656:Itgam UTSW 7 128116815 missense probably null 1.00
R2913:Itgam UTSW 7 128112406 missense probably damaging 1.00
R3116:Itgam UTSW 7 128116029 missense probably damaging 1.00
R3404:Itgam UTSW 7 128070703 unclassified probably null
R3821:Itgam UTSW 7 128112286 splice site probably null
R3822:Itgam UTSW 7 128112286 splice site probably null
R3960:Itgam UTSW 7 128115175 missense probably benign 0.02
R3968:Itgam UTSW 7 128113033 missense probably damaging 1.00
R4192:Itgam UTSW 7 128064732 missense probably benign 0.21
R4400:Itgam UTSW 7 128081658 missense probably damaging 1.00
R4708:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4709:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4742:Itgam UTSW 7 128113073 missense probably damaging 1.00
R4790:Itgam UTSW 7 128116273 missense probably benign 0.01
R4960:Itgam UTSW 7 128115840 missense possibly damaging 0.93
R5109:Itgam UTSW 7 128113218 missense probably benign 0.06
R5190:Itgam UTSW 7 128116317 unclassified probably null
R5379:Itgam UTSW 7 128112388 missense probably damaging 1.00
R5386:Itgam UTSW 7 128107980 missense probably benign 0.00
R6104:Itgam UTSW 7 128116302 missense possibly damaging 0.85
R6122:Itgam UTSW 7 128085652 missense probably damaging 0.99
R6189:Itgam UTSW 7 128112504 missense probably benign 0.04
R6282:Itgam UTSW 7 128084942 missense probably benign 0.01
R6545:Itgam UTSW 7 128107872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATCCTGACTCTGTAGCTG -3'
(R):5'- AGCATTATTGTGGCATAGATATGTGGC -3'

Sequencing Primer
(F):5'- GCCTCATGCCGGATGCTAAC -3'
(R):5'- CATAGATATGTGGCAGCTGGGC -3'
Posted On2014-09-18