Incidental Mutation 'R2106:Rapgef6'
ID230988
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 040110-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 54668686 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 1050 (I1050S)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
Predicted Effect probably benign
Transcript: ENSMUST00000094536
AA Change: I765S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: I765S

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
AA Change: I1050S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: I1050S

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
AA Change: I1050S

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: I1050S

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
AA Change: I765S

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: I765S

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: I1055S

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTATCAAGTCTTAAAAGGGAGTGGG -3'
(R):5'- AGGGAGGTTGACTATTGCTTACC -3'

Sequencing Primer
(F):5'- ACACTTACCTGTACTCAGG -3'
(R):5'- GACTATTGCTTACCTGTGAGGATTAC -3'
Posted On2014-09-18