Incidental Mutation 'R2106:Rad51d'
ID230991
Institutional Source Beutler Lab
Gene Symbol Rad51d
Ensembl Gene ENSMUSG00000018841
Gene NameRAD51 paralog D
SynonymsR51H3, Rad51d
MMRRC Submission 040110-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82876434-82890614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82879308 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 261 (K261N)
Ref Sequence ENSEMBL: ENSMUSP00000018985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018985] [ENSMUST00000021033] [ENSMUST00000092844] [ENSMUST00000100718] [ENSMUST00000135963] [ENSMUST00000146053]
Predicted Effect probably damaging
Transcript: ENSMUST00000018985
AA Change: K261N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000018985
Gene: ENSMUSG00000018841
AA Change: K261N

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 2e-27 PDB
AAA 99 274 1.5e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000021033
AA Change: K207N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021033
Gene: ENSMUSG00000018841
AA Change: K207N

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 249 3e-15 PFAM
Pfam:AAA_25 69 200 2e-12 PFAM
Pfam:KaiC 82 148 1.4e-10 PFAM
Pfam:AAA_19 93 168 6.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092844
AA Change: K216N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090520
Gene: ENSMUSG00000018841
AA Change: K216N

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 66 130 2.4e-7 PFAM
Pfam:KaiC 82 129 8e-8 PFAM
Pfam:Rad51 115 274 8.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100718
SMART Domains Protein: ENSMUSP00000098284
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 5e-30 PDB
SCOP:d1b22a_ 10 48 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135963
SMART Domains Protein: ENSMUSP00000122477
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 219 7e-18 PFAM
Pfam:AAA_25 69 226 2.6e-15 PFAM
Pfam:KaiC 82 216 5.7e-12 PFAM
Pfam:AAA_19 93 168 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146053
SMART Domains Protein: ENSMUSP00000117401
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 48 1e-13 PDB
SCOP:d1b22a_ 10 48 7e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene belongs to the Rad51 gene family whose products play a major role in homologous recombination and DNA repair. The encoded protein interacts with other proteins of this family, including Rad51b, Rad51c and Xrcc2, and plays an essential role in both DNA repair and telomere maintenance. In humans, germline mutations in this gene may be associated with predisposition to ovarian cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Rad51d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rad51d APN 11 82889746 missense probably damaging 1.00
IGL02755:Rad51d APN 11 82881632 missense probably benign 0.05
IGL03270:Rad51d APN 11 82881594 splice site probably benign
spew UTSW 11 82879333 missense probably damaging 0.99
R0179:Rad51d UTSW 11 82889998 missense possibly damaging 0.90
R1440:Rad51d UTSW 11 82890353 nonsense probably null
R1771:Rad51d UTSW 11 82883938 missense probably damaging 1.00
R2340:Rad51d UTSW 11 82881821 missense probably damaging 1.00
R5396:Rad51d UTSW 11 82890370 missense possibly damaging 0.90
R6917:Rad51d UTSW 11 82879333 missense probably damaging 0.99
R6941:Rad51d UTSW 11 82889797 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGGCATGGAAACCACTCTC -3'
(R):5'- ACTGAGGCTTTGTGGAGAGC -3'

Sequencing Primer
(F):5'- TGGAAACCACTCTCTCCAGGG -3'
(R):5'- AGCTGGGTGCAAGCCAG -3'
Posted On2014-09-18