Incidental Mutation 'R2106:Mast4'
ID231004
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission 040110-MU
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102750546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1204 (V1204I)
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099202
AA Change: V1027I

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751
AA Change: V1027I

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166726
AA Change: V1137I
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751
AA Change: V1137I

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167058
AA Change: V1204I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751
AA Change: V1204I

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000167462
AA Change: V945I
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751
AA Change: V945I

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171791
AA Change: V1012I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751
AA Change: V1012I

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172264
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000194446
AA Change: V1036I
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ttc23l A G 15: 10,547,256 C91R probably damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7453:Mast4 UTSW 13 102804641 critical splice donor site probably null
R7514:Mast4 UTSW 13 102787426 nonsense probably null
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAGCTTTGCTTCCGGTC -3'
(R):5'- GTCCATGTTAGGAACTTAGGATCG -3'

Sequencing Primer
(F):5'- GCTTCCGGTCAGACTTCTG -3'
(R):5'- TAGGATCGTTCCCAAAGTGACTC -3'
Posted On2014-09-18