Incidental Mutation 'R2106:Ttc23l'
ID231006
Institutional Source Beutler Lab
Gene Symbol Ttc23l
Ensembl Gene ENSMUSG00000022249
Gene Nametetratricopeptide repeat domain 23-like
Synonyms4930401A09Rik
MMRRC Submission 040110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R2106 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location10500102-10558668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10547256 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 91 (C91R)
Ref Sequence ENSEMBL: ENSMUSP00000155921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022857] [ENSMUST00000166039] [ENSMUST00000167842] [ENSMUST00000167842]
Predicted Effect probably damaging
Transcript: ENSMUST00000022857
AA Change: C91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022857
Gene: ENSMUSG00000022249
AA Change: C91R

DomainStartEndE-ValueType
TPR 159 192 4.21e1 SMART
Blast:TPR 208 239 2e-6 BLAST
TPR 250 283 1.4e1 SMART
low complexity region 292 303 N/A INTRINSIC
TPR 376 409 9.53e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166039
SMART Domains Protein: ENSMUSP00000131180
Gene: ENSMUSG00000022249

DomainStartEndE-ValueType
Blast:TPR 183 209 9e-11 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000167842
AA Change: C91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127781
Gene: ENSMUSG00000022249
AA Change: C91R

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
Pfam:TPR_1 102 133 3.3e-6 PFAM
low complexity region 148 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167842
AA Change: C91R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 T C 2: 27,102,825 F650S probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Akr1c13 T A 13: 4,198,594 V266E probably damaging Het
Ankrd61 A T 5: 143,891,746 L95Q probably damaging Het
Atp11a A G 8: 12,835,228 T22A probably benign Het
Brca1 A G 11: 101,524,977 V777A possibly damaging Het
Ccdc40 G T 11: 119,264,297 R1121L probably damaging Het
Cdhr4 A C 9: 107,997,494 S588R possibly damaging Het
Cfap69 T C 5: 5,595,979 N517D probably benign Het
Chrm2 T C 6: 36,523,447 Y80H probably damaging Het
Csgalnact2 G T 6: 118,109,129 Y534* probably null Het
Defb35 A G 8: 21,940,793 E61G unknown Het
Dhx15 A T 5: 52,170,086 D95E probably benign Het
Dhx57 A G 17: 80,275,363 V271A probably damaging Het
Dlg1 T C 16: 31,812,756 S444P probably damaging Het
Edem1 T A 6: 108,848,725 N406K probably damaging Het
Eif4g3 A T 4: 138,082,919 probably benign Het
Epb41 A G 4: 131,989,841 I56T probably damaging Het
Epg5 T A 18: 77,991,363 Y1442* probably null Het
Fam166a A G 2: 25,220,651 Y157C probably damaging Het
Fat2 T C 11: 55,256,564 T3951A probably benign Het
Fryl A G 5: 73,098,331 S786P probably damaging Het
Fyb2 A G 4: 104,945,572 T224A probably benign Het
Ginm1 A T 10: 7,775,326 F105L probably damaging Het
Heatr1 T C 13: 12,412,058 V688A probably benign Het
Hnmt T G 2: 24,019,118 Q94H probably benign Het
Ice1 A G 13: 70,605,622 Y782H probably benign Het
Immt T C 6: 71,871,515 V418A possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kif1b G A 4: 149,187,640 S1568L possibly damaging Het
Krt84 T C 15: 101,530,866 N248D probably damaging Het
Lig1 C A 7: 13,305,938 R692S probably damaging Het
Lvrn G T 18: 46,878,289 A438S probably damaging Het
Mast4 C T 13: 102,750,546 V1204I probably damaging Het
Med21 G T 6: 146,649,212 D74Y probably damaging Het
Nat8 T C 6: 85,830,524 D209G probably benign Het
Nipal1 C A 5: 72,663,559 F132L probably damaging Het
Npr2 A T 4: 43,644,329 I613F probably damaging Het
Nrcam A G 12: 44,570,290 T706A probably benign Het
Olfr1132 T C 2: 87,635,159 E196G probably benign Het
Olfr1133 A G 2: 87,645,551 S191P probably damaging Het
Pam A G 1: 97,831,490 V823A probably damaging Het
Pdik1l A T 4: 134,284,254 Y93N probably damaging Het
Perm1 T C 4: 156,218,879 W627R probably damaging Het
Pofut1 G A 2: 153,259,793 probably null Het
Prmt5 T C 14: 54,507,917 I598V probably benign Het
Rab11fip5 T C 6: 85,374,387 I48V probably damaging Het
Rad51d T A 11: 82,879,308 K261N probably damaging Het
Rapgef6 T G 11: 54,668,686 I1050S probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ryr3 T C 2: 112,638,129 E4688G probably damaging Het
Siva1 G T 12: 112,647,006 R96L probably damaging Het
Slc13a4 T C 6: 35,287,864 N140S probably damaging Het
Slc26a5 T A 5: 21,823,544 D342V probably damaging Het
Slfn9 A G 11: 82,987,680 S208P possibly damaging Het
Sspo C A 6: 48,466,316 T1899N possibly damaging Het
Sytl1 T C 4: 133,257,463 D200G probably benign Het
Tas2r118 T C 6: 23,969,570 N164S probably benign Het
Tbc1d17 A G 7: 44,848,268 probably null Het
Tex14 T C 11: 87,486,250 M140T possibly damaging Het
Tm6sf2 T C 8: 70,079,746 F352S probably benign Het
Tmem88 A G 11: 69,397,859 L78P probably benign Het
Trafd1 A G 5: 121,373,211 S515P probably benign Het
Trpm6 A T 19: 18,813,350 E583V possibly damaging Het
Ubap1l T C 9: 65,373,807 S256P probably benign Het
Vmn1r26 T G 6: 58,008,725 S160R possibly damaging Het
Vmn2r97 A G 17: 18,947,838 S785G probably damaging Het
Wdr27 T G 17: 14,920,854 R278S probably benign Het
Wdr7 T C 18: 63,778,038 S834P probably damaging Het
Zdhhc12 C T 2: 30,091,802 C116Y probably damaging Het
Zfp946 T C 17: 22,453,485 F22L probably benign Het
Zfp948 G T 17: 21,587,691 E382* probably null Het
Zfp956 T A 6: 47,964,425 *573K probably null Het
Zim1 T G 7: 6,678,074 T197P probably benign Het
Other mutations in Ttc23l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Ttc23l APN 15 10530689 missense probably damaging 1.00
IGL01319:Ttc23l APN 15 10509406 splice site probably benign
IGL01562:Ttc23l APN 15 10551390 splice site probably benign
IGL01969:Ttc23l APN 15 10551434 nonsense probably null
IGL03172:Ttc23l APN 15 10537566 missense probably benign 0.06
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0042:Ttc23l UTSW 15 10551541 missense probably damaging 1.00
R0335:Ttc23l UTSW 15 10539963 missense probably benign 0.26
R0554:Ttc23l UTSW 15 10530657 missense probably benign 0.12
R0609:Ttc23l UTSW 15 10504536 missense probably benign
R0631:Ttc23l UTSW 15 10539980 missense probably damaging 1.00
R1703:Ttc23l UTSW 15 10523658 missense probably damaging 1.00
R2220:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2276:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2277:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2278:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2279:Ttc23l UTSW 15 10523592 missense possibly damaging 0.92
R2368:Ttc23l UTSW 15 10537562 small insertion probably benign
R2368:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2420:Ttc23l UTSW 15 10537562 small insertion probably benign
R2420:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2421:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2422:Ttc23l UTSW 15 10537562 small insertion probably benign
R2422:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2830:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537562 small insertion probably benign
R2831:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2979:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2980:Ttc23l UTSW 15 10537562 small insertion probably benign
R2980:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2981:Ttc23l UTSW 15 10537562 small insertion probably benign
R2981:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2982:Ttc23l UTSW 15 10537562 small insertion probably benign
R2982:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R2983:Ttc23l UTSW 15 10537562 small insertion probably benign
R2983:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3176:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3177:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3276:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3277:Ttc23l UTSW 15 10547232 missense possibly damaging 0.83
R3722:Ttc23l UTSW 15 10537562 small insertion probably benign
R3722:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3743:Ttc23l UTSW 15 10537562 small insertion probably benign
R3743:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R3767:Ttc23l UTSW 15 10530695 missense possibly damaging 0.94
R3921:Ttc23l UTSW 15 10537562 small insertion probably benign
R3921:Ttc23l UTSW 15 10537563 small insertion probably benign
R3921:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4091:Ttc23l UTSW 15 10537562 small insertion probably benign
R4091:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4119:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4120:Ttc23l UTSW 15 10539920 missense probably damaging 1.00
R4373:Ttc23l UTSW 15 10537562 small insertion probably benign
R4373:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4375:Ttc23l UTSW 15 10537562 small insertion probably benign
R4375:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4376:Ttc23l UTSW 15 10537562 small insertion probably benign
R4376:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R4377:Ttc23l UTSW 15 10537562 small insertion probably benign
R4377:Ttc23l UTSW 15 10537566 missense probably benign 0.06
R5002:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5106:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5107:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5109:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5156:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5157:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5160:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5161:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5259:Ttc23l UTSW 15 10515150 missense probably damaging 0.99
R5307:Ttc23l UTSW 15 10533659 missense probably damaging 1.00
R5728:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5756:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5772:Ttc23l UTSW 15 10551469 missense probably benign 0.01
R5793:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5794:Ttc23l UTSW 15 10551550 missense possibly damaging 0.95
R5847:Ttc23l UTSW 15 10537596 missense probably benign 0.07
R6976:Ttc23l UTSW 15 10537580 nonsense probably null
R7010:Ttc23l UTSW 15 10515138 missense probably damaging 1.00
Z1088:Ttc23l UTSW 15 10533667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCTCCTTTGTCCATGGAG -3'
(R):5'- AGAACTTGGTTTTAGGGTACACG -3'

Sequencing Primer
(F):5'- AGTTAAGTGGGGCGTCCTCC -3'
(R):5'- TACACGTAGGAGGTGGAGCC -3'
Posted On2014-09-18