Incidental Mutation 'R2117:Ints14'
ID231089
Institutional Source Beutler Lab
Gene Symbol Ints14
Ensembl Gene ENSMUSG00000034263
Gene Nameintegrator complex subunit 14
SynonymsVwa9, 2010321M09Rik
MMRRC Submission 040121-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R2117 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64960905-64986978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64979795 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 336 (L336R)
Ref Sequence ENSEMBL: ENSMUSP00000127420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037504] [ENSMUST00000170517]
Predicted Effect probably damaging
Transcript: ENSMUST00000037504
AA Change: L336R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049284
Gene: ENSMUSG00000034263
AA Change: L336R

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170517
AA Change: L336R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127420
Gene: ENSMUSG00000034263
AA Change: L336R

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Meta Mutation Damage Score 0.462 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,492,537 C3357S probably benign Het
Ago1 T A 4: 126,463,857 probably null Het
Akap10 A T 11: 61,890,303 D562E possibly damaging Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Asph G A 4: 9,517,671 Q468* probably null Het
Bcam G T 7: 19,758,427 A581E possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Casc1 C T 6: 145,205,241 probably null Het
Ccr6 T C 17: 8,256,082 F40L possibly damaging Het
Cfap161 A T 7: 83,775,976 N302K possibly damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Cpsf6 A G 10: 117,366,120 probably benign Het
Ctnna1 A G 18: 35,152,625 N8S possibly damaging Het
Cyp2d11 A G 15: 82,391,753 L209P probably damaging Het
Dab2 T C 15: 6,435,615 V628A probably damaging Het
Dcstamp C T 15: 39,755,175 Q327* probably null Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dlg5 A T 14: 24,177,758 L365* probably null Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Exoc3l2 G T 7: 19,494,982 L108F possibly damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Fam83h C A 15: 76,004,733 E252* probably null Het
Fancm A G 12: 65,077,174 D202G probably damaging Het
Fat1 T A 8: 45,037,463 V3804E probably benign Het
Fbxw28 T C 9: 109,330,917 T190A probably benign Het
Fer1l4 T C 2: 156,039,118 T843A probably benign Het
Fnip1 A T 11: 54,500,624 H461L probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gemin4 A G 11: 76,211,001 V978A possibly damaging Het
Gm7247 A T 14: 51,365,335 I43F probably damaging Het
Gm853 C A 4: 130,215,363 V295L possibly damaging Het
Gm9978 C T 10: 78,486,897 noncoding transcript Het
Gpr4 T C 7: 19,223,145 S331P probably damaging Het
Hspa1a T A 17: 34,970,479 N483Y probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lamb3 A G 1: 193,334,181 R657G probably benign Het
Lrp2 A C 2: 69,483,385 V2334G probably benign Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Map3k21 A T 8: 125,924,042 H261L probably benign Het
Meis1 G T 11: 18,881,679 P453Q probably damaging Het
Mettl16 G T 11: 74,802,929 M255I probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mpp5 T C 12: 78,809,922 F180L possibly damaging Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Nav2 A G 7: 49,464,580 I771V probably benign Het
Nisch A T 14: 31,177,285 probably benign Het
Npc1 G A 18: 12,196,556 P990L probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1378 A T 11: 50,969,320 I101F probably damaging Het
Olfr1402 C A 3: 97,410,449 C244F probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Otogl T C 10: 107,858,918 D823G probably benign Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pank1 T A 19: 34,841,086 I18F probably damaging Het
Pgap3 A G 11: 98,391,107 L126P probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pkd2 G A 5: 104,483,176 E489K probably damaging Het
Prdm16 T A 4: 154,347,925 S296C probably null Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prmt7 A G 8: 106,227,298 T124A probably damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rap2b G T 3: 61,365,091 G12V probably damaging Het
Rapgef5 T A 12: 117,714,064 probably null Het
Rassf4 A G 6: 116,645,127 F168S possibly damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sacs A G 14: 61,213,771 K4422R probably benign Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sema3d C T 5: 12,563,273 T439I probably benign Het
Sephs1 A G 2: 4,899,540 N243S probably benign Het
Setd2 TTGGGA T 9: 110,604,144 probably null Het
Setx A G 2: 29,130,301 D100G probably benign Het
Slc22a7 C A 17: 46,433,972 V383L possibly damaging Het
Slc25a40 T C 5: 8,430,417 C56R probably damaging Het
Stk38l T A 6: 146,768,846 L229I probably damaging Het
Sult2a5 T C 7: 13,625,434 S112P probably damaging Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Tlr9 A G 9: 106,225,337 N609S probably damaging Het
Tmem120a A T 5: 135,736,123 S266T possibly damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem8 C T 17: 26,117,884 L259F possibly damaging Het
Tnfrsf18 T A 4: 156,028,516 V196E probably damaging Het
Trpc1 A T 9: 95,717,584 L474H probably damaging Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp47 T A 7: 112,067,236 probably null Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Vmn1r26 T C 6: 58,008,350 N285D possibly damaging Het
Zfp445 T A 9: 122,853,437 K480* probably null Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zfp821 A G 8: 109,721,219 E64G probably damaging Het
Zfp994 T A 17: 22,200,981 D329V probably damaging Het
Zkscan8 T C 13: 21,520,318 S484G probably damaging Het
Other mutations in Ints14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Ints14 APN 9 64972792 missense probably benign 0.30
R0376:Ints14 UTSW 9 64983990 missense probably damaging 0.98
R0589:Ints14 UTSW 9 64979831 missense probably damaging 1.00
R0614:Ints14 UTSW 9 64964433 missense probably benign
R0708:Ints14 UTSW 9 64983984 missense probably benign 0.29
R1192:Ints14 UTSW 9 64966763 missense possibly damaging 0.86
R2114:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2115:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2484:Ints14 UTSW 9 64986084 missense probably benign
R4811:Ints14 UTSW 9 64964518 missense probably damaging 1.00
R4953:Ints14 UTSW 9 64982058 missense probably damaging 1.00
R5067:Ints14 UTSW 9 64964412 missense probably damaging 1.00
R6080:Ints14 UTSW 9 64966762 missense probably benign 0.02
R6326:Ints14 UTSW 9 64964437 missense probably benign 0.08
R6395:Ints14 UTSW 9 64978124 splice site probably null
R7036:Ints14 UTSW 9 64964545 missense probably benign
R7147:Ints14 UTSW 9 64983985 missense possibly damaging 0.93
R7203:Ints14 UTSW 9 64964419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCAGTGCACACAGAGC -3'
(R):5'- TCCGTGTATGCACCCACATC -3'

Sequencing Primer
(F):5'- ACACACACACAGTTTTGTCTG -3'
(R):5'- GTGTATGCACCCACATCAGAGAG -3'
Posted On2014-09-18