Incidental Mutation 'R2117:Otogl'
ID231097
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Nameotogelin-like
SynonymsGm6924
MMRRC Submission 040121-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2117 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location107760531-107912134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107858918 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 823 (D823G)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
Predicted Effect probably benign
Transcript: ENSMUST00000165341
AA Change: D823G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: D823G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,492,537 C3357S probably benign Het
Ago1 T A 4: 126,463,857 probably null Het
Akap10 A T 11: 61,890,303 D562E possibly damaging Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Asph G A 4: 9,517,671 Q468* probably null Het
Bcam G T 7: 19,758,427 A581E possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Casc1 C T 6: 145,205,241 probably null Het
Ccr6 T C 17: 8,256,082 F40L possibly damaging Het
Cfap161 A T 7: 83,775,976 N302K possibly damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Cpsf6 A G 10: 117,366,120 probably benign Het
Ctnna1 A G 18: 35,152,625 N8S possibly damaging Het
Cyp2d11 A G 15: 82,391,753 L209P probably damaging Het
Dab2 T C 15: 6,435,615 V628A probably damaging Het
Dcstamp C T 15: 39,755,175 Q327* probably null Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dlg5 A T 14: 24,177,758 L365* probably null Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Exoc3l2 G T 7: 19,494,982 L108F possibly damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Fam83h C A 15: 76,004,733 E252* probably null Het
Fancm A G 12: 65,077,174 D202G probably damaging Het
Fat1 T A 8: 45,037,463 V3804E probably benign Het
Fbxw28 T C 9: 109,330,917 T190A probably benign Het
Fer1l4 T C 2: 156,039,118 T843A probably benign Het
Fnip1 A T 11: 54,500,624 H461L probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gemin4 A G 11: 76,211,001 V978A possibly damaging Het
Gm7247 A T 14: 51,365,335 I43F probably damaging Het
Gm853 C A 4: 130,215,363 V295L possibly damaging Het
Gm9978 C T 10: 78,486,897 noncoding transcript Het
Gpr4 T C 7: 19,223,145 S331P probably damaging Het
Hspa1a T A 17: 34,970,479 N483Y probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lamb3 A G 1: 193,334,181 R657G probably benign Het
Lrp2 A C 2: 69,483,385 V2334G probably benign Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Map3k21 A T 8: 125,924,042 H261L probably benign Het
Meis1 G T 11: 18,881,679 P453Q probably damaging Het
Mettl16 G T 11: 74,802,929 M255I probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mpp5 T C 12: 78,809,922 F180L possibly damaging Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Nav2 A G 7: 49,464,580 I771V probably benign Het
Nisch A T 14: 31,177,285 probably benign Het
Npc1 G A 18: 12,196,556 P990L probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1378 A T 11: 50,969,320 I101F probably damaging Het
Olfr1402 C A 3: 97,410,449 C244F probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pank1 T A 19: 34,841,086 I18F probably damaging Het
Pgap3 A G 11: 98,391,107 L126P probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pkd2 G A 5: 104,483,176 E489K probably damaging Het
Prdm16 T A 4: 154,347,925 S296C probably null Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prmt7 A G 8: 106,227,298 T124A probably damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rap2b G T 3: 61,365,091 G12V probably damaging Het
Rapgef5 T A 12: 117,714,064 probably null Het
Rassf4 A G 6: 116,645,127 F168S possibly damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sacs A G 14: 61,213,771 K4422R probably benign Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sema3d C T 5: 12,563,273 T439I probably benign Het
Sephs1 A G 2: 4,899,540 N243S probably benign Het
Setd2 TTGGGA T 9: 110,604,144 probably null Het
Setx A G 2: 29,130,301 D100G probably benign Het
Slc22a7 C A 17: 46,433,972 V383L possibly damaging Het
Slc25a40 T C 5: 8,430,417 C56R probably damaging Het
Stk38l T A 6: 146,768,846 L229I probably damaging Het
Sult2a5 T C 7: 13,625,434 S112P probably damaging Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Tlr9 A G 9: 106,225,337 N609S probably damaging Het
Tmem120a A T 5: 135,736,123 S266T possibly damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem8 C T 17: 26,117,884 L259F possibly damaging Het
Tnfrsf18 T A 4: 156,028,516 V196E probably damaging Het
Trpc1 A T 9: 95,717,584 L474H probably damaging Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp47 T A 7: 112,067,236 probably null Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Vmn1r26 T C 6: 58,008,350 N285D possibly damaging Het
Zfp445 T A 9: 122,853,437 K480* probably null Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zfp821 A G 8: 109,721,219 E64G probably damaging Het
Zfp994 T A 17: 22,200,981 D329V probably damaging Het
Zkscan8 T C 13: 21,520,318 S484G probably damaging Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107910956 missense probably benign 0.00
R0084:Otogl UTSW 10 107901341 missense probably damaging 0.96
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0164:Otogl UTSW 10 107874530 missense probably damaging 0.97
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0238:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0239:Otogl UTSW 10 107806696 missense probably damaging 0.98
R0294:Otogl UTSW 10 107777228 missense probably damaging 1.00
R0360:Otogl UTSW 10 107770650 splice site probably benign
R0442:Otogl UTSW 10 107876855 missense probably damaging 1.00
R0488:Otogl UTSW 10 107803605 missense probably benign 0.02
R0507:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0573:Otogl UTSW 10 107780988 missense probably benign 0.00
R0581:Otogl UTSW 10 107789040 missense possibly damaging 0.79
R0613:Otogl UTSW 10 107817070 missense probably damaging 0.99
R0614:Otogl UTSW 10 107798355 missense probably benign 0.14
R0742:Otogl UTSW 10 107866740 missense possibly damaging 0.51
R0846:Otogl UTSW 10 107772296 missense probably benign 0.40
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1146:Otogl UTSW 10 107886513 missense probably damaging 1.00
R1439:Otogl UTSW 10 107779252 missense probably benign 0.02
R1457:Otogl UTSW 10 107878152 splice site probably null
R1526:Otogl UTSW 10 107869526 missense probably damaging 1.00
R1662:Otogl UTSW 10 107798357 missense possibly damaging 0.84
R1664:Otogl UTSW 10 107806576 missense probably benign 0.00
R1667:Otogl UTSW 10 107813965 nonsense probably null
R1695:Otogl UTSW 10 107814017 missense probably damaging 0.99
R1731:Otogl UTSW 10 107817111 missense probably damaging 1.00
R1733:Otogl UTSW 10 107783712 missense possibly damaging 0.46
R1764:Otogl UTSW 10 107899461 nonsense probably null
R1824:Otogl UTSW 10 107779831 missense probably benign
R1850:Otogl UTSW 10 107878064 missense probably damaging 1.00
R1856:Otogl UTSW 10 107854264 missense possibly damaging 0.92
R1875:Otogl UTSW 10 107899590 missense probably damaging 1.00
R1938:Otogl UTSW 10 107777575 missense probably damaging 0.98
R1986:Otogl UTSW 10 107794190 critical splice acceptor site probably null
R2072:Otogl UTSW 10 107781043 missense probably damaging 1.00
R2219:Otogl UTSW 10 107856977 missense probably damaging 1.00
R2508:Otogl UTSW 10 107874500 missense probably damaging 0.99
R2883:Otogl UTSW 10 107768981 missense probably damaging 1.00
R2931:Otogl UTSW 10 107820004 missense possibly damaging 0.85
R3620:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3621:Otogl UTSW 10 107874371 missense probably damaging 0.99
R3735:Otogl UTSW 10 107899529 nonsense probably null
R3812:Otogl UTSW 10 107899471 missense probably damaging 1.00
R3880:Otogl UTSW 10 107827704 missense probably damaging 0.96
R3958:Otogl UTSW 10 107821925 missense probably damaging 1.00
R4063:Otogl UTSW 10 107790649 missense probably benign 0.02
R4064:Otogl UTSW 10 107790649 missense probably benign 0.02
R4108:Otogl UTSW 10 107771244 missense probably benign 0.01
R4352:Otogl UTSW 10 107869535 missense probably damaging 1.00
R4526:Otogl UTSW 10 107886980 missense probably damaging 1.00
R4614:Otogl UTSW 10 107892124 nonsense probably null
R4703:Otogl UTSW 10 107821924 missense probably damaging 1.00
R4741:Otogl UTSW 10 107779260 missense probably benign 0.00
R4790:Otogl UTSW 10 107822033 critical splice acceptor site probably null
R4801:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4802:Otogl UTSW 10 107901336 missense probably damaging 1.00
R4910:Otogl UTSW 10 107879517 missense probably benign 0.05
R4913:Otogl UTSW 10 107876855 missense probably damaging 0.98
R5238:Otogl UTSW 10 107768973 missense probably damaging 1.00
R5261:Otogl UTSW 10 107777592 missense probably benign 0.16
R5387:Otogl UTSW 10 107780933 missense probably benign 0.03
R5395:Otogl UTSW 10 107817138 missense probably benign 0.39
R5403:Otogl UTSW 10 107808756 missense probably benign 0.08
R5482:Otogl UTSW 10 107821941 missense probably damaging 0.99
R5547:Otogl UTSW 10 107782048 missense possibly damaging 0.55
R5611:Otogl UTSW 10 107786769 missense probably damaging 1.00
R5642:Otogl UTSW 10 107886552 missense probably benign 0.44
R5690:Otogl UTSW 10 107777117 synonymous silent
R5711:Otogl UTSW 10 107777117 synonymous silent
R5731:Otogl UTSW 10 107881464 missense probably damaging 0.98
R5743:Otogl UTSW 10 107857001 missense possibly damaging 0.67
R5782:Otogl UTSW 10 107777117 synonymous silent
R5820:Otogl UTSW 10 107777117 synonymous silent
R5897:Otogl UTSW 10 107777117 synonymous silent
R6004:Otogl UTSW 10 107879529 missense probably damaging 1.00
R6145:Otogl UTSW 10 107777117 synonymous silent
R6146:Otogl UTSW 10 107777117 synonymous silent
R6147:Otogl UTSW 10 107777117 synonymous silent
R6149:Otogl UTSW 10 107881453 missense probably benign 0.36
R6226:Otogl UTSW 10 107771206 nonsense probably null
R6283:Otogl UTSW 10 107790500 missense probably damaging 0.98
R6414:Otogl UTSW 10 107782050 missense probably damaging 1.00
R6604:Otogl UTSW 10 107822034 splice site probably null
R6634:Otogl UTSW 10 107862304 missense probably damaging 1.00
R6727:Otogl UTSW 10 107777117 synonymous silent
R6755:Otogl UTSW 10 107853303 nonsense probably null
R6795:Otogl UTSW 10 107777117 synonymous silent
R6797:Otogl UTSW 10 107777117 synonymous silent
R6864:Otogl UTSW 10 107827806 missense probably damaging 0.96
R6924:Otogl UTSW 10 107808641 missense probably damaging 1.00
R6967:Otogl UTSW 10 107814050 missense probably benign 0.01
R7000:Otogl UTSW 10 107779831 missense probably benign
R7075:Otogl UTSW 10 107778929 missense probably benign 0.16
R7122:Otogl UTSW 10 107866654 missense probably benign 0.08
R7176:Otogl UTSW 10 107778911 missense probably damaging 1.00
R7184:Otogl UTSW 10 107763200 missense probably damaging 1.00
R7199:Otogl UTSW 10 107874533 missense possibly damaging 0.88
R7252:Otogl UTSW 10 107821943 missense probably benign 0.06
R7286:Otogl UTSW 10 107770610 missense probably benign 0.00
X0065:Otogl UTSW 10 107895782 missense probably damaging 1.00
X0067:Otogl UTSW 10 107866677 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGGGAATCATTGGAACG -3'
(R):5'- ATAAGCATTTGGGTCAGGCTAG -3'

Sequencing Primer
(F):5'- CGTGGTTCTGAATGCATGATACTAC -3'
(R):5'- TTGGGTCAGGCTAGTAACAATACC -3'
Posted On2014-09-18