Incidental Mutation 'R2117:Fancm'
ID231112
Institutional Source Beutler Lab
Gene Symbol Fancm
Ensembl Gene ENSMUSG00000055884
Gene NameFanconi anemia, complementation group M
SynonymsD12Ertd364e, C730036B14Rik
MMRRC Submission 040121-MU
Accession Numbers

Ncbi RefSeq: NM_178912.3; MGI:2442306

Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R2117 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location65075603-65132058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65077174 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 202 (D202G)
Ref Sequence ENSEMBL: ENSMUSP00000054797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021332] [ENSMUST00000058889] [ENSMUST00000220730] [ENSMUST00000221166] [ENSMUST00000221913] [ENSMUST00000222540]
Predicted Effect probably benign
Transcript: ENSMUST00000021332
SMART Domains Protein: ENSMUSP00000021332
Gene: ENSMUSG00000020949

DomainStartEndE-ValueType
PDB:2KFV|A 1 73 2e-45 PDB
low complexity region 91 100 N/A INTRINSIC
Pfam:FKBP_C 121 221 3.9e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058889
AA Change: D202G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054797
Gene: ENSMUSG00000055884
AA Change: D202G

DomainStartEndE-ValueType
DEXDc 75 275 5.6e-25 SMART
Blast:DEXDc 295 323 9e-6 BLAST
low complexity region 339 348 N/A INTRINSIC
HELICc 475 566 5.64e-21 SMART
Pfam:FANCM-MHF_bd 657 770 8.5e-50 PFAM
low complexity region 850 866 N/A INTRINSIC
low complexity region 974 987 N/A INTRINSIC
low complexity region 1105 1120 N/A INTRINSIC
low complexity region 1165 1178 N/A INTRINSIC
PDB:4DAY|C 1207 1238 1e-6 PDB
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 1669 1682 N/A INTRINSIC
ERCC4 1780 1863 2.07e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220730
Predicted Effect probably benign
Transcript: ENSMUST00000220983
Predicted Effect probably benign
Transcript: ENSMUST00000221166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221710
Predicted Effect probably benign
Transcript: ENSMUST00000221913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222467
Predicted Effect probably damaging
Transcript: ENSMUST00000222540
AA Change: D202G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223519
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 4355560
Lethality: D500-D600
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group M. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female transmission, hypogonadism, premature death, and increased incidence of tumors. [provided by MGI curators]
Allele List at MGI

All alleles(39) : Targeted(4) Gene trapped(35)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,492,537 C3357S probably benign Het
Ago1 T A 4: 126,463,857 probably null Het
Akap10 A T 11: 61,890,303 D562E possibly damaging Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Asph G A 4: 9,517,671 Q468* probably null Het
Bcam G T 7: 19,758,427 A581E possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Casc1 C T 6: 145,205,241 probably null Het
Ccr6 T C 17: 8,256,082 F40L possibly damaging Het
Cfap161 A T 7: 83,775,976 N302K possibly damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Cpsf6 A G 10: 117,366,120 probably benign Het
Ctnna1 A G 18: 35,152,625 N8S possibly damaging Het
Cyp2d11 A G 15: 82,391,753 L209P probably damaging Het
Dab2 T C 15: 6,435,615 V628A probably damaging Het
Dcstamp C T 15: 39,755,175 Q327* probably null Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dlg5 A T 14: 24,177,758 L365* probably null Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Exoc3l2 G T 7: 19,494,982 L108F possibly damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Fam83h C A 15: 76,004,733 E252* probably null Het
Fat1 T A 8: 45,037,463 V3804E probably benign Het
Fbxw28 T C 9: 109,330,917 T190A probably benign Het
Fer1l4 T C 2: 156,039,118 T843A probably benign Het
Fnip1 A T 11: 54,500,624 H461L probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gemin4 A G 11: 76,211,001 V978A possibly damaging Het
Gm7247 A T 14: 51,365,335 I43F probably damaging Het
Gm853 C A 4: 130,215,363 V295L possibly damaging Het
Gm9978 C T 10: 78,486,897 noncoding transcript Het
Gpr4 T C 7: 19,223,145 S331P probably damaging Het
Hspa1a T A 17: 34,970,479 N483Y probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lamb3 A G 1: 193,334,181 R657G probably benign Het
Lrp2 A C 2: 69,483,385 V2334G probably benign Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Map3k21 A T 8: 125,924,042 H261L probably benign Het
Meis1 G T 11: 18,881,679 P453Q probably damaging Het
Mettl16 G T 11: 74,802,929 M255I probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mpp5 T C 12: 78,809,922 F180L possibly damaging Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Nav2 A G 7: 49,464,580 I771V probably benign Het
Nisch A T 14: 31,177,285 probably benign Het
Npc1 G A 18: 12,196,556 P990L probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1378 A T 11: 50,969,320 I101F probably damaging Het
Olfr1402 C A 3: 97,410,449 C244F probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Otogl T C 10: 107,858,918 D823G probably benign Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pank1 T A 19: 34,841,086 I18F probably damaging Het
Pgap3 A G 11: 98,391,107 L126P probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pkd2 G A 5: 104,483,176 E489K probably damaging Het
Prdm16 T A 4: 154,347,925 S296C probably null Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prmt7 A G 8: 106,227,298 T124A probably damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rap2b G T 3: 61,365,091 G12V probably damaging Het
Rapgef5 T A 12: 117,714,064 probably null Het
Rassf4 A G 6: 116,645,127 F168S possibly damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sacs A G 14: 61,213,771 K4422R probably benign Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sema3d C T 5: 12,563,273 T439I probably benign Het
Sephs1 A G 2: 4,899,540 N243S probably benign Het
Setd2 TTGGGA T 9: 110,604,144 probably null Het
Setx A G 2: 29,130,301 D100G probably benign Het
Slc22a7 C A 17: 46,433,972 V383L possibly damaging Het
Slc25a40 T C 5: 8,430,417 C56R probably damaging Het
Stk38l T A 6: 146,768,846 L229I probably damaging Het
Sult2a5 T C 7: 13,625,434 S112P probably damaging Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Tlr9 A G 9: 106,225,337 N609S probably damaging Het
Tmem120a A T 5: 135,736,123 S266T possibly damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem8 C T 17: 26,117,884 L259F possibly damaging Het
Tnfrsf18 T A 4: 156,028,516 V196E probably damaging Het
Trpc1 A T 9: 95,717,584 L474H probably damaging Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp47 T A 7: 112,067,236 probably null Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Vmn1r26 T C 6: 58,008,350 N285D possibly damaging Het
Zfp445 T A 9: 122,853,437 K480* probably null Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zfp821 A G 8: 109,721,219 E64G probably damaging Het
Zfp994 T A 17: 22,200,981 D329V probably damaging Het
Zkscan8 T C 13: 21,520,318 S484G probably damaging Het
Other mutations in Fancm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Fancm APN 12 65075736 missense possibly damaging 0.50
IGL00489:Fancm APN 12 65106193 missense probably benign 0.01
IGL00529:Fancm APN 12 65130417 utr 3 prime probably benign
IGL00898:Fancm APN 12 65106000 missense probably benign 0.01
IGL01805:Fancm APN 12 65113861 critical splice donor site probably null
IGL01986:Fancm APN 12 65126655 nonsense probably null
IGL02026:Fancm APN 12 65105734 missense probably benign 0.03
IGL02069:Fancm APN 12 65075911 missense probably benign 0.05
IGL02103:Fancm APN 12 65095784 missense probably benign 0.38
IGL02133:Fancm APN 12 65106475 missense probably benign 0.04
IGL02400:Fancm APN 12 65113815 missense probably damaging 1.00
IGL02478:Fancm APN 12 65077090 missense probably damaging 1.00
IGL02479:Fancm APN 12 65106485 missense probably damaging 0.98
IGL02563:Fancm APN 12 65092462 missense probably damaging 1.00
IGL02606:Fancm APN 12 65076139 missense possibly damaging 0.90
IGL02731:Fancm APN 12 65088305 missense probably benign 0.00
IGL02809:Fancm APN 12 65121667 missense possibly damaging 0.54
IGL02953:Fancm APN 12 65121966 missense probably benign 0.27
IGL03066:Fancm APN 12 65125114 nonsense probably null
IGL03073:Fancm APN 12 65101632 missense probably damaging 1.00
PIT4131001:Fancm UTSW 12 65105422 missense probably benign 0.03
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0041:Fancm UTSW 12 65106443 nonsense probably null
R0125:Fancm UTSW 12 65121956 missense possibly damaging 0.68
R0201:Fancm UTSW 12 65101632 missense probably damaging 1.00
R0360:Fancm UTSW 12 65075950 missense probably damaging 1.00
R0491:Fancm UTSW 12 65106061 missense probably benign 0.32
R0557:Fancm UTSW 12 65118442 critical splice donor site probably null
R0617:Fancm UTSW 12 65097317 nonsense probably null
R1201:Fancm UTSW 12 65106768 missense possibly damaging 0.66
R1353:Fancm UTSW 12 65088170 missense probably damaging 1.00
R1456:Fancm UTSW 12 65118351 missense possibly damaging 0.48
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1468:Fancm UTSW 12 65099293 missense probably damaging 1.00
R1521:Fancm UTSW 12 65121704 missense probably benign 0.25
R1530:Fancm UTSW 12 65092490 critical splice donor site probably null
R1559:Fancm UTSW 12 65093689 missense probably benign 0.00
R1632:Fancm UTSW 12 65130331 missense probably damaging 1.00
R1681:Fancm UTSW 12 65105656 missense probably benign 0.03
R1919:Fancm UTSW 12 65105520 missense possibly damaging 0.48
R1969:Fancm UTSW 12 65101692 missense probably benign 0.09
R1971:Fancm UTSW 12 65101692 missense probably benign 0.09
R2510:Fancm UTSW 12 65113770 splice site probably benign
R2909:Fancm UTSW 12 65124856 missense probably damaging 1.00
R3155:Fancm UTSW 12 65116421 missense probably benign 0.32
R3405:Fancm UTSW 12 65075772 missense probably benign 0.00
R4133:Fancm UTSW 12 65120530 missense probably benign 0.44
R4308:Fancm UTSW 12 65126531 missense probably benign 0.14
R4588:Fancm UTSW 12 65118441 critical splice donor site probably null
R4602:Fancm UTSW 12 65124944 missense probably benign 0.12
R4653:Fancm UTSW 12 65083054 missense probably damaging 0.99
R4702:Fancm UTSW 12 65122052 missense possibly damaging 0.95
R4719:Fancm UTSW 12 65121706 missense possibly damaging 0.64
R4885:Fancm UTSW 12 65102643 nonsense probably null
R4896:Fancm UTSW 12 65075831 missense probably damaging 1.00
R4908:Fancm UTSW 12 65094871 missense probably benign 0.28
R4921:Fancm UTSW 12 65077141 missense probably benign 0.19
R4922:Fancm UTSW 12 65106892 critical splice donor site probably null
R4948:Fancm UTSW 12 65090974 missense probably damaging 1.00
R5103:Fancm UTSW 12 65105858 missense probably damaging 0.99
R5577:Fancm UTSW 12 65130411 utr 3 prime probably benign
R5631:Fancm UTSW 12 65113843 missense probably damaging 0.97
R5741:Fancm UTSW 12 65101615 missense probably benign 0.01
R6137:Fancm UTSW 12 65130382 missense probably damaging 1.00
R6167:Fancm UTSW 12 65094895 missense probably benign 0.42
R6242:Fancm UTSW 12 65116442 missense probably benign 0.01
R6242:Fancm UTSW 12 65116449 missense probably benign 0.00
R6281:Fancm UTSW 12 65088270 missense probably damaging 1.00
R6325:Fancm UTSW 12 65125052 missense probably damaging 1.00
R6434:Fancm UTSW 12 65077168 missense probably damaging 1.00
R6493:Fancm UTSW 12 65097488 missense probably benign 0.04
R6542:Fancm UTSW 12 65097429 missense probably damaging 1.00
R6645:Fancm UTSW 12 65106100 missense probably damaging 0.99
R6878:Fancm UTSW 12 65116423 nonsense probably null
R7171:Fancm UTSW 12 65101620 missense probably damaging 0.99
R7172:Fancm UTSW 12 65106054 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGATGACGGTCTGAAGTTTCTG -3'
(R):5'- AGATTTCCCAGCACCCTCTG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- TGTTCTGACAGAGTGAATGAAAGGC -3'
Posted On2014-09-18