Incidental Mutation 'R2117:Sacs'
ID231121
Institutional Source Beutler Lab
Gene Symbol Sacs
Ensembl Gene ENSMUSG00000048279
Gene Namesacsin
SynonymsE130115J16Rik
MMRRC Submission 040121-MU
Accession Numbers

Genbank: NM_172809; MGI: 1354724; Ensembl: ENSMUST00000119943

Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R2117 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61138457-61240695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61213771 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 4422 (K4422R)
Ref Sequence ENSEMBL: ENSMUSP00000113377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089394] [ENSMUST00000119943]
Predicted Effect probably benign
Transcript: ENSMUST00000089394
SMART Domains Protein: ENSMUSP00000086816
Gene: ENSMUSG00000048279

DomainStartEndE-ValueType
SCOP:d1lm8b_ 8 66 3e-3 SMART
Blast:UBQ 9 81 3e-31 BLAST
Blast:HATPase_c 116 211 2e-10 BLAST
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119943
AA Change: K4422R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113377
Gene: ENSMUSG00000048279
AA Change: K4422R

DomainStartEndE-ValueType
internal_repeat_1 61 514 1.35e-52 PROSPERO
low complexity region 608 623 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
low complexity region 1019 1033 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1526 1537 N/A INTRINSIC
low complexity region 2454 2463 N/A INTRINSIC
internal_repeat_1 2475 2934 1.35e-52 PROSPERO
low complexity region 3751 3760 N/A INTRINSIC
low complexity region 3997 4012 N/A INTRINSIC
low complexity region 4285 4300 N/A INTRINSIC
Blast:DnaJ 4304 4363 1e-31 BLAST
PDB:1IUR|A 4309 4376 5e-39 PDB
SCOP:d1gh6a_ 4317 4407 2e-3 SMART
HEPN 4454 4570 9.49e-24 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit Purkinje cell degeneration with thickened tortuous dendrites and altered mitochondrial dysfunction. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,492,537 C3357S probably benign Het
Ago1 T A 4: 126,463,857 probably null Het
Akap10 A T 11: 61,890,303 D562E possibly damaging Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Asph G A 4: 9,517,671 Q468* probably null Het
Bcam G T 7: 19,758,427 A581E possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Casc1 C T 6: 145,205,241 probably null Het
Ccr6 T C 17: 8,256,082 F40L possibly damaging Het
Cfap161 A T 7: 83,775,976 N302K possibly damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Cpsf6 A G 10: 117,366,120 probably benign Het
Ctnna1 A G 18: 35,152,625 N8S possibly damaging Het
Cyp2d11 A G 15: 82,391,753 L209P probably damaging Het
Dab2 T C 15: 6,435,615 V628A probably damaging Het
Dcstamp C T 15: 39,755,175 Q327* probably null Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dlg5 A T 14: 24,177,758 L365* probably null Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Exoc3l2 G T 7: 19,494,982 L108F possibly damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Fam83h C A 15: 76,004,733 E252* probably null Het
Fancm A G 12: 65,077,174 D202G probably damaging Het
Fat1 T A 8: 45,037,463 V3804E probably benign Het
Fbxw28 T C 9: 109,330,917 T190A probably benign Het
Fer1l4 T C 2: 156,039,118 T843A probably benign Het
Fnip1 A T 11: 54,500,624 H461L probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gemin4 A G 11: 76,211,001 V978A possibly damaging Het
Gm7247 A T 14: 51,365,335 I43F probably damaging Het
Gm853 C A 4: 130,215,363 V295L possibly damaging Het
Gm9978 C T 10: 78,486,897 noncoding transcript Het
Gpr4 T C 7: 19,223,145 S331P probably damaging Het
Hspa1a T A 17: 34,970,479 N483Y probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lamb3 A G 1: 193,334,181 R657G probably benign Het
Lrp2 A C 2: 69,483,385 V2334G probably benign Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Map3k21 A T 8: 125,924,042 H261L probably benign Het
Meis1 G T 11: 18,881,679 P453Q probably damaging Het
Mettl16 G T 11: 74,802,929 M255I probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mpp5 T C 12: 78,809,922 F180L possibly damaging Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Nav2 A G 7: 49,464,580 I771V probably benign Het
Nisch A T 14: 31,177,285 probably benign Het
Npc1 G A 18: 12,196,556 P990L probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1378 A T 11: 50,969,320 I101F probably damaging Het
Olfr1402 C A 3: 97,410,449 C244F probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Otogl T C 10: 107,858,918 D823G probably benign Het
P2rx7 A G 5: 122,681,266 T584A probably benign Het
Pank1 T A 19: 34,841,086 I18F probably damaging Het
Pgap3 A G 11: 98,391,107 L126P probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pkd2 G A 5: 104,483,176 E489K probably damaging Het
Prdm16 T A 4: 154,347,925 S296C probably null Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prmt7 A G 8: 106,227,298 T124A probably damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rap2b G T 3: 61,365,091 G12V probably damaging Het
Rapgef5 T A 12: 117,714,064 probably null Het
Rassf4 A G 6: 116,645,127 F168S possibly damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sema3d C T 5: 12,563,273 T439I probably benign Het
Sephs1 A G 2: 4,899,540 N243S probably benign Het
Setd2 TTGGGA T 9: 110,604,144 probably null Het
Setx A G 2: 29,130,301 D100G probably benign Het
Slc22a7 C A 17: 46,433,972 V383L possibly damaging Het
Slc25a40 T C 5: 8,430,417 C56R probably damaging Het
Stk38l T A 6: 146,768,846 L229I probably damaging Het
Sult2a5 T C 7: 13,625,434 S112P probably damaging Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tenm2 A G 11: 36,024,854 L1951P probably damaging Het
Tlr9 A G 9: 106,225,337 N609S probably damaging Het
Tmem120a A T 5: 135,736,123 S266T possibly damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem8 C T 17: 26,117,884 L259F possibly damaging Het
Tnfrsf18 T A 4: 156,028,516 V196E probably damaging Het
Trpc1 A T 9: 95,717,584 L474H probably damaging Het
Trpm6 T C 19: 18,829,952 V1020A probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp47 T A 7: 112,067,236 probably null Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Vmn1r26 T C 6: 58,008,350 N285D possibly damaging Het
Zfp445 T A 9: 122,853,437 K480* probably null Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zfp821 A G 8: 109,721,219 E64G probably damaging Het
Zfp994 T A 17: 22,200,981 D329V probably damaging Het
Zkscan8 T C 13: 21,520,318 S484G probably damaging Het
Other mutations in Sacs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Sacs APN 14 61191635 missense possibly damaging 0.64
IGL01839:Sacs APN 14 61183945 intron probably benign
IGL02024:Sacs APN 14 61189678 missense probably damaging 0.96
IGL02247:Sacs APN 14 61192535 missense probably damaging 1.00
F6893:Sacs UTSW 14 61212976 missense probably benign
IGL03052:Sacs UTSW 14 61207858 missense probably damaging 0.99
R0090:Sacs UTSW 14 61205440 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0102:Sacs UTSW 14 61204568 missense probably damaging 1.00
R0390:Sacs UTSW 14 61205640 missense possibly damaging 0.92
R0479:Sacs UTSW 14 61191479 missense probably damaging 0.99
R0556:Sacs UTSW 14 61183958 missense probably damaging 0.99
R0673:Sacs UTSW 14 61210215 missense possibly damaging 0.89
R0748:Sacs UTSW 14 61209265 missense probably damaging 0.99
R0931:Sacs UTSW 14 61203495 missense probably benign
R0972:Sacs UTSW 14 61211963 nonsense probably null
R1281:Sacs UTSW 14 61191801 missense probably benign 0.02
R1340:Sacs UTSW 14 61204509 missense probably damaging 0.98
R1351:Sacs UTSW 14 61202761 missense probably benign 0.00
R1499:Sacs UTSW 14 61213704 missense possibly damaging 0.70
R1538:Sacs UTSW 14 61210059 missense probably damaging 0.98
R1581:Sacs UTSW 14 61213679 missense probably damaging 0.96
R1599:Sacs UTSW 14 61203638 missense probably benign
R1631:Sacs UTSW 14 61210732 nonsense probably null
R1635:Sacs UTSW 14 61203828 missense probably damaging 0.98
R1655:Sacs UTSW 14 61191782 missense probably benign
R1660:Sacs UTSW 14 61209009 missense probably damaging 0.99
R1707:Sacs UTSW 14 61209762 missense probably benign 0.01
R1733:Sacs UTSW 14 61205454 missense probably damaging 1.00
R1772:Sacs UTSW 14 61210897 missense probably damaging 1.00
R1976:Sacs UTSW 14 61202895 missense probably benign
R2055:Sacs UTSW 14 61214049 missense probably damaging 0.97
R2083:Sacs UTSW 14 61206506 missense possibly damaging 0.69
R2091:Sacs UTSW 14 61191919 missense possibly damaging 0.95
R2105:Sacs UTSW 14 61173441 missense possibly damaging 0.90
R2109:Sacs UTSW 14 61173453 splice site probably null
R2122:Sacs UTSW 14 61212316 missense probably damaging 1.00
R2148:Sacs UTSW 14 61173378 missense probably damaging 0.97
R2151:Sacs UTSW 14 61209640 missense probably damaging 1.00
R2231:Sacs UTSW 14 61205929 unclassified probably null
R2248:Sacs UTSW 14 61212802 missense probably damaging 1.00
R2271:Sacs UTSW 14 61204660 missense probably benign 0.06
R2314:Sacs UTSW 14 61207759 missense probably benign 0.17
R2436:Sacs UTSW 14 61202905 missense possibly damaging 0.94
R2445:Sacs UTSW 14 61205206 missense probably damaging 1.00
R2512:Sacs UTSW 14 61203080 missense probably benign 0.00
R3434:Sacs UTSW 14 61212303 missense probably damaging 1.00
R3785:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3786:Sacs UTSW 14 61183961 missense probably damaging 1.00
R3796:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3798:Sacs UTSW 14 61206121 missense possibly damaging 0.87
R3872:Sacs UTSW 14 61148068 missense probably benign 0.30
R3873:Sacs UTSW 14 61192286 missense possibly damaging 0.64
R3892:Sacs UTSW 14 61204387 missense probably damaging 0.98
R4184:Sacs UTSW 14 61213944 missense probably damaging 0.97
R4204:Sacs UTSW 14 61173443 missense possibly damaging 0.93
R4249:Sacs UTSW 14 61203457 missense probably benign 0.02
R4256:Sacs UTSW 14 61206337 missense probably damaging 1.00
R4370:Sacs UTSW 14 61212309 missense probably damaging 1.00
R4445:Sacs UTSW 14 61204686 missense probably benign 0.30
R4503:Sacs UTSW 14 61207603 missense probably damaging 1.00
R4548:Sacs UTSW 14 61191938 missense probably damaging 1.00
R4582:Sacs UTSW 14 61191698 missense probably damaging 1.00
R4613:Sacs UTSW 14 61211797 intron probably null
R4639:Sacs UTSW 14 61207268 missense probably benign 0.12
R4697:Sacs UTSW 14 61212747 missense probably benign 0.19
R4706:Sacs UTSW 14 61204273 missense probably damaging 1.00
R4717:Sacs UTSW 14 61212855 missense probably damaging 1.00
R4777:Sacs UTSW 14 61211809 missense probably damaging 1.00
R4888:Sacs UTSW 14 61212198 missense probably damaging 1.00
R4913:Sacs UTSW 14 61213797 missense probably benign 0.17
R4973:Sacs UTSW 14 61213122 missense probably damaging 1.00
R4986:Sacs UTSW 14 61213043 nonsense probably null
R5090:Sacs UTSW 14 61205253 missense probably damaging 1.00
R5243:Sacs UTSW 14 61205957 nonsense probably null
R5292:Sacs UTSW 14 61211983 missense probably damaging 1.00
R5308:Sacs UTSW 14 61192400 missense probably benign 0.21
R5337:Sacs UTSW 14 61193514 intron probably benign
R5502:Sacs UTSW 14 61206100 missense probably damaging 1.00
R5586:Sacs UTSW 14 61206441 nonsense probably null
R5692:Sacs UTSW 14 61207839 missense probably benign 0.00
R5725:Sacs UTSW 14 61211110 missense probably damaging 1.00
R5854:Sacs UTSW 14 61211547 missense probably damaging 1.00
R5959:Sacs UTSW 14 61212400 missense probably damaging 0.99
R5960:Sacs UTSW 14 61208695 missense probably benign 0.30
R5968:Sacs UTSW 14 61189629 missense probably damaging 0.99
R5983:Sacs UTSW 14 61205199 missense probably damaging 1.00
R5992:Sacs UTSW 14 61205543 missense probably damaging 1.00
R6076:Sacs UTSW 14 61204536 nonsense probably null
R6175:Sacs UTSW 14 61212826 missense possibly damaging 0.82
R6347:Sacs UTSW 14 61211160 missense probably damaging 1.00
R6357:Sacs UTSW 14 61208824 missense possibly damaging 0.47
R6415:Sacs UTSW 14 61205359 missense probably damaging 1.00
R6469:Sacs UTSW 14 61191248 missense probably damaging 1.00
R6503:Sacs UTSW 14 61211361 missense probably benign 0.00
R6523:Sacs UTSW 14 61202961 missense probably damaging 0.99
R6615:Sacs UTSW 14 61208934 missense probably benign 0.15
R6729:Sacs UTSW 14 61210518 missense probably damaging 1.00
R6731:Sacs UTSW 14 61180700 intron probably null
R6797:Sacs UTSW 14 61213073 missense probably damaging 1.00
R6852:Sacs UTSW 14 61179288 missense possibly damaging 0.87
R6922:Sacs UTSW 14 61211425 missense probably damaging 1.00
X0067:Sacs UTSW 14 61208019 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTCAAGCACCTGCAGAATG -3'
(R):5'- CCAGCTTGGTGGAAAGGTAAC -3'

Sequencing Primer
(F):5'- TGTTCAAGCACCTGCAGAATGAAATC -3'
(R):5'- CTTGGTGGAAAGGTAACACTTG -3'
Posted On2014-09-18