Incidental Mutation 'R2118:Cfhr1'
ID231161
Institutional Source Beutler Lab
Gene Symbol Cfhr1
Ensembl Gene ENSMUSG00000057037
Gene Namecomplement factor H-related 1
SynonymsCfhl1
MMRRC Submission 040122-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2118 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139547053-139560272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 139550904 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 243 (Q243E)
Ref Sequence ENSEMBL: ENSMUSP00000023965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023965]
Predicted Effect probably benign
Transcript: ENSMUST00000023965
AA Change: Q243E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023965
Gene: ENSMUSG00000057037
AA Change: Q243E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 88 1.12e-4 SMART
CCP 92 145 3.48e-10 SMART
CCP 154 208 4.95e-15 SMART
CCP 215 269 3.5e-15 SMART
CCP 273 334 1.04e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161224
AA Change: Q62E
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein belonging to the complement factor H protein family. It binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. It is proposed that Tuf acts as a virulence factor by acquiring host proteins to the pathogen surface, controlling complement, and facilitating tissue invasion. Mutations in this gene are associated with an increased risk of atypical hemolytic-uremic syndrome. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cnih2 C A 19: 5,098,248 A6S possibly damaging Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Gnptab T C 10: 88,436,398 S967P probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Spag17 A G 3: 100,049,240 E884G possibly damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Cfhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cfhr1 APN 1 139556515 unclassified probably benign
IGL00656:Cfhr1 APN 1 139547755 unclassified probably benign
IGL01099:Cfhr1 APN 1 139547759 unclassified probably benign
IGL01101:Cfhr1 APN 1 139553584 missense probably benign 0.11
IGL01617:Cfhr1 APN 1 139553679 nonsense probably null
IGL01732:Cfhr1 APN 1 139550868 missense probably benign 0.02
IGL01935:Cfhr1 APN 1 139551002 missense probably benign 0.26
IGL02368:Cfhr1 APN 1 139547813 unclassified probably benign
IGL02456:Cfhr1 APN 1 139556393 missense possibly damaging 0.88
IGL03105:Cfhr1 APN 1 139547827 unclassified probably benign
R0681:Cfhr1 UTSW 1 139557511 missense probably damaging 0.99
R1466:Cfhr1 UTSW 1 139557574 missense probably benign 0.17
R1466:Cfhr1 UTSW 1 139557574 missense probably benign 0.17
R1829:Cfhr1 UTSW 1 139553600 missense probably damaging 1.00
R2082:Cfhr1 UTSW 1 139550886 missense possibly damaging 0.72
R3747:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R3748:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R3749:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R4208:Cfhr1 UTSW 1 139547878 unclassified probably benign
R4566:Cfhr1 UTSW 1 139553648 missense possibly damaging 0.82
R4681:Cfhr1 UTSW 1 139550929 nonsense probably null
R4839:Cfhr1 UTSW 1 139560133 missense probably damaging 1.00
R5208:Cfhr1 UTSW 1 139556330 critical splice donor site probably null
R5572:Cfhr1 UTSW 1 139556427 missense possibly damaging 0.78
R6043:Cfhr1 UTSW 1 139550868 missense probably benign 0.01
R6176:Cfhr1 UTSW 1 139550916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGCACTGAAGCACTGATC -3'
(R):5'- GAAAGCCTCATAAGCATTCTTTAGC -3'

Sequencing Primer
(F):5'- GCACTGAAGCACTGATCAAACAATAC -3'
(R):5'- CTTCTTAGATCCAACAGGGA -3'
Posted On2014-09-18