Incidental Mutation 'R2118:Ash1l'
ID 231171
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene Name ASH1 like histone lysine methyltransferase
Synonyms E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor
MMRRC Submission 040122-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2118 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 88857929-88986682 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 88892602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Glutamic Acid at position 1494 (Q1494E)
Ref Sequence ENSEMBL: ENSMUSP00000140251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090933
AA Change: Q1494E

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: Q1494E

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186583
AA Change: Q1494E

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: Q1494E

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Meta Mutation Damage Score 0.0956 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,331,190 (GRCm39) S31P possibly damaging Het
4933430I17Rik T A 4: 62,457,109 (GRCm39) L143M possibly damaging Het
Abca13 T C 11: 9,259,013 (GRCm39) probably benign Het
Abcg5 T A 17: 84,978,575 (GRCm39) E294D probably benign Het
Abi3bp T C 16: 56,298,227 (GRCm39) probably benign Het
Adamts8 T C 9: 30,854,359 (GRCm39) F76S probably damaging Het
Agpat3 T C 10: 78,113,918 (GRCm39) R257G probably damaging Het
Ahctf1 C A 1: 179,597,017 (GRCm39) R43L probably damaging Het
AI593442 T C 9: 52,588,993 (GRCm39) T195A probably benign Het
Aipl1 A T 11: 71,920,195 (GRCm39) L291Q possibly damaging Het
Ambn T A 5: 88,608,617 (GRCm39) probably benign Het
Arap2 G A 5: 62,864,028 (GRCm39) T532I probably damaging Het
Arg1 T C 10: 24,796,621 (GRCm39) N69D possibly damaging Het
Arhgef10 A G 8: 14,984,820 (GRCm39) D200G probably damaging Het
Arhgef38 T C 3: 132,866,514 (GRCm39) K208E probably benign Het
Asb4 A T 6: 5,390,687 (GRCm39) T27S probably benign Het
Car12 T C 9: 66,621,174 (GRCm39) V15A probably benign Het
Cdc20b A G 13: 113,215,232 (GRCm39) I267V probably benign Het
Cdh1 A G 8: 107,390,842 (GRCm39) I653V probably benign Het
Cenpe T A 3: 134,952,645 (GRCm39) M1445K possibly damaging Het
Cfap43 T C 19: 47,758,877 (GRCm39) E932G probably damaging Het
Cfhr1 G C 1: 139,478,642 (GRCm39) Q243E probably benign Het
Cnih2 C A 19: 5,148,276 (GRCm39) A6S possibly damaging Het
Cntnap1 G T 11: 101,079,483 (GRCm39) M1240I probably benign Het
Cntrl T C 2: 35,051,977 (GRCm39) S1050P probably benign Het
Cyp2a12 A G 7: 26,736,071 (GRCm39) *493W probably null Het
Dbx2 A C 15: 95,522,681 (GRCm39) L342R probably damaging Het
Dmd G C X: 83,356,089 (GRCm39) A2257P probably benign Het
Dnajb2 T C 1: 75,214,121 (GRCm39) W30R probably damaging Het
Ecel1 A G 1: 87,075,997 (GRCm39) S727P probably damaging Het
Ednrb T A 14: 104,059,204 (GRCm39) D274V probably benign Het
Fam78b G A 1: 166,906,278 (GRCm39) V146M probably damaging Het
Fancd2 A G 6: 113,537,035 (GRCm39) probably benign Het
Fbxw14 T C 9: 109,103,692 (GRCm39) probably benign Het
Gimap4 G T 6: 48,667,905 (GRCm39) C92F probably benign Het
Gm10033 A C 8: 69,824,942 (GRCm39) noncoding transcript Het
Gm5828 A G 1: 16,840,199 (GRCm39) noncoding transcript Het
Gnpat T C 8: 125,603,680 (GRCm39) V186A probably damaging Het
Gnptab T C 10: 88,272,260 (GRCm39) S967P probably benign Het
Ikbkb T C 8: 23,157,233 (GRCm39) probably benign Het
Il1rap A T 16: 26,529,315 (GRCm39) H379L probably damaging Het
Ints12 T C 3: 132,814,921 (GRCm39) V376A probably damaging Het
Kalrn C T 16: 34,152,600 (GRCm39) S309N possibly damaging Het
Kel T A 6: 41,666,234 (GRCm39) I471L probably benign Het
Klhl25 T C 7: 75,516,480 (GRCm39) V462A probably damaging Het
Ksr1 A T 11: 78,936,019 (GRCm39) M77K probably benign Het
Leo1 T A 9: 75,353,094 (GRCm39) N212K probably damaging Het
Ltbp1 T A 17: 75,617,154 (GRCm39) V1031E possibly damaging Het
Ltbr A G 6: 125,286,440 (GRCm39) S249P probably benign Het
Mast4 A G 13: 102,890,713 (GRCm39) V855A probably damaging Het
Mdga2 T A 12: 66,915,526 (GRCm39) E43V probably damaging Het
Mmaa A T 8: 79,994,588 (GRCm39) L406* probably null Het
Mtcl2 T C 2: 156,875,245 (GRCm39) E835G probably damaging Het
Nlrp12 A T 7: 3,290,079 (GRCm39) N144K probably damaging Het
Nlrp6 T C 7: 140,506,357 (GRCm39) V766A probably benign Het
Or4f61 C A 2: 111,922,675 (GRCm39) V124L probably benign Het
Or5h18 A G 16: 58,848,178 (GRCm39) F31L possibly damaging Het
Pabpc4l T C 3: 46,401,276 (GRCm39) T123A probably benign Het
Pappa2 T C 1: 158,684,836 (GRCm39) T768A probably damaging Het
Pde6d A G 1: 86,473,524 (GRCm39) F91L probably benign Het
Ppp1r13l A G 7: 19,105,346 (GRCm39) M373V possibly damaging Het
Prss37 G A 6: 40,492,294 (GRCm39) R186* probably null Het
Psg16 C A 7: 16,824,548 (GRCm39) H111N probably benign Het
Psg20 T A 7: 18,414,947 (GRCm39) Y316F probably benign Het
Psmd1 T A 1: 86,006,422 (GRCm39) S263T possibly damaging Het
Rai14 A G 15: 10,575,252 (GRCm39) F569L probably benign Het
Rbpms2 T A 9: 65,558,229 (GRCm39) D116E probably damaging Het
Rgs20 A G 1: 4,987,113 (GRCm39) probably benign Het
Rnf114 T C 2: 167,352,803 (GRCm39) L101P probably damaging Het
Rnf168 T G 16: 32,097,036 (GRCm39) L37R probably damaging Het
Rpe T C 1: 66,754,387 (GRCm39) M153T probably damaging Het
Sap18 T A 14: 58,036,011 (GRCm39) S66T probably damaging Het
Slc2a13 A G 15: 91,400,679 (GRCm39) V181A probably damaging Het
Spag17 A G 3: 99,956,556 (GRCm39) E884G possibly damaging Het
Sycn T C 7: 28,240,713 (GRCm39) S127P probably damaging Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tas2r117 T A 6: 132,780,129 (GRCm39) I89K probably damaging Het
Tep1 C A 14: 51,093,029 (GRCm39) probably null Het
Tex14 T C 11: 87,410,569 (GRCm39) probably benign Het
Tll1 T C 8: 64,538,591 (GRCm39) E351G probably benign Het
Tmem44 T A 16: 30,366,262 (GRCm39) K55* probably null Het
Trak1 T A 9: 121,302,063 (GRCm39) *940R probably null Het
Vmn1r200 C T 13: 22,579,353 (GRCm39) T43I probably damaging Het
Wars2 T C 3: 99,123,883 (GRCm39) V248A probably benign Het
Wfdc6b C T 2: 164,459,363 (GRCm39) R142C probably benign Het
Zfp729a A T 13: 67,769,613 (GRCm39) probably null Het
Zfp759 C A 13: 67,287,578 (GRCm39) probably benign Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88,889,019 (GRCm39) missense probably benign 0.19
IGL00819:Ash1l APN 3 88,915,043 (GRCm39) missense possibly damaging 0.68
IGL00939:Ash1l APN 3 88,942,543 (GRCm39) missense probably damaging 0.99
IGL01064:Ash1l APN 3 88,979,791 (GRCm39) missense probably damaging 1.00
IGL01066:Ash1l APN 3 88,891,942 (GRCm39) missense probably damaging 1.00
IGL01087:Ash1l APN 3 88,971,209 (GRCm39) missense probably damaging 1.00
IGL01293:Ash1l APN 3 88,890,836 (GRCm39) missense probably benign 0.01
IGL01541:Ash1l APN 3 88,973,572 (GRCm39) missense probably damaging 1.00
IGL01863:Ash1l APN 3 88,892,813 (GRCm39) nonsense probably null
IGL02326:Ash1l APN 3 88,873,364 (GRCm39) missense probably benign 0.00
IGL02407:Ash1l APN 3 88,979,855 (GRCm39) missense probably damaging 1.00
IGL02419:Ash1l APN 3 88,892,872 (GRCm39) missense probably benign 0.00
IGL02422:Ash1l APN 3 88,976,386 (GRCm39) critical splice donor site probably null
IGL02494:Ash1l APN 3 88,973,525 (GRCm39) nonsense probably null
IGL02727:Ash1l APN 3 88,930,344 (GRCm39) missense probably benign
IGL02732:Ash1l APN 3 88,873,535 (GRCm39) missense probably damaging 1.00
IGL02817:Ash1l APN 3 88,892,108 (GRCm39) missense probably damaging 1.00
IGL02887:Ash1l APN 3 88,891,488 (GRCm39) missense probably benign 0.11
IGL03224:Ash1l APN 3 88,942,575 (GRCm39) splice site probably benign
IGL03253:Ash1l APN 3 88,891,981 (GRCm39) missense probably damaging 1.00
IGL03327:Ash1l APN 3 88,930,390 (GRCm39) missense probably benign 0.02
IGL03398:Ash1l APN 3 88,914,527 (GRCm39) missense probably benign 0.01
3-1:Ash1l UTSW 3 88,873,633 (GRCm39) missense probably benign
BB008:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
BB018:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
R0068:Ash1l UTSW 3 88,914,624 (GRCm39) missense probably benign 0.17
R0068:Ash1l UTSW 3 88,914,624 (GRCm39) missense probably benign 0.17
R0239:Ash1l UTSW 3 88,974,529 (GRCm39) missense possibly damaging 0.49
R0239:Ash1l UTSW 3 88,974,529 (GRCm39) missense possibly damaging 0.49
R0395:Ash1l UTSW 3 88,965,896 (GRCm39) missense probably damaging 1.00
R0477:Ash1l UTSW 3 88,890,766 (GRCm39) missense probably benign 0.41
R0528:Ash1l UTSW 3 88,889,584 (GRCm39) missense probably benign
R0543:Ash1l UTSW 3 88,971,085 (GRCm39) splice site probably null
R0855:Ash1l UTSW 3 88,961,761 (GRCm39) missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88,892,194 (GRCm39) missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88,892,194 (GRCm39) missense possibly damaging 0.72
R1163:Ash1l UTSW 3 88,942,570 (GRCm39) critical splice donor site probably null
R1196:Ash1l UTSW 3 88,890,623 (GRCm39) missense probably damaging 0.99
R1419:Ash1l UTSW 3 88,892,204 (GRCm39) missense probably damaging 0.99
R1445:Ash1l UTSW 3 88,914,659 (GRCm39) missense probably benign 0.02
R1466:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1466:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1480:Ash1l UTSW 3 88,892,359 (GRCm39) missense probably damaging 1.00
R1506:Ash1l UTSW 3 88,965,806 (GRCm39) missense probably damaging 0.99
R1537:Ash1l UTSW 3 88,979,783 (GRCm39) missense probably damaging 0.99
R1584:Ash1l UTSW 3 88,959,372 (GRCm39) missense probably damaging 1.00
R1669:Ash1l UTSW 3 88,974,549 (GRCm39) critical splice donor site probably null
R1713:Ash1l UTSW 3 88,983,531 (GRCm39) missense probably damaging 1.00
R1780:Ash1l UTSW 3 88,873,291 (GRCm39) missense probably benign
R1793:Ash1l UTSW 3 88,977,616 (GRCm39) missense probably damaging 1.00
R1881:Ash1l UTSW 3 88,888,862 (GRCm39) missense probably benign 0.00
R1909:Ash1l UTSW 3 88,891,835 (GRCm39) missense probably benign 0.29
R1938:Ash1l UTSW 3 88,891,729 (GRCm39) missense probably damaging 0.98
R2035:Ash1l UTSW 3 88,973,624 (GRCm39) missense probably benign 0.00
R2070:Ash1l UTSW 3 88,873,510 (GRCm39) missense probably damaging 1.00
R2071:Ash1l UTSW 3 88,873,510 (GRCm39) missense probably damaging 1.00
R2114:Ash1l UTSW 3 88,890,571 (GRCm39) missense probably benign 0.00
R2116:Ash1l UTSW 3 88,890,571 (GRCm39) missense probably benign 0.00
R2143:Ash1l UTSW 3 88,892,726 (GRCm39) missense probably benign 0.09
R2164:Ash1l UTSW 3 88,892,726 (GRCm39) missense probably benign 0.09
R2210:Ash1l UTSW 3 88,973,605 (GRCm39) missense probably damaging 1.00
R2247:Ash1l UTSW 3 88,914,674 (GRCm39) missense possibly damaging 0.77
R2303:Ash1l UTSW 3 88,933,733 (GRCm39) missense probably damaging 1.00
R2860:Ash1l UTSW 3 88,961,785 (GRCm39) missense probably damaging 1.00
R2861:Ash1l UTSW 3 88,961,785 (GRCm39) missense probably damaging 1.00
R3104:Ash1l UTSW 3 88,961,693 (GRCm39) missense probably damaging 1.00
R4133:Ash1l UTSW 3 88,889,567 (GRCm39) missense probably benign 0.00
R4164:Ash1l UTSW 3 88,889,273 (GRCm39) missense probably damaging 0.97
R4270:Ash1l UTSW 3 88,889,347 (GRCm39) missense probably benign 0.26
R4271:Ash1l UTSW 3 88,889,347 (GRCm39) missense probably benign 0.26
R4287:Ash1l UTSW 3 88,973,722 (GRCm39) missense probably damaging 0.99
R4409:Ash1l UTSW 3 88,914,506 (GRCm39) missense probably damaging 0.99
R4459:Ash1l UTSW 3 88,873,541 (GRCm39) missense probably damaging 0.99
R4487:Ash1l UTSW 3 88,892,622 (GRCm39) missense possibly damaging 0.65
R4674:Ash1l UTSW 3 88,979,783 (GRCm39) missense possibly damaging 0.80
R4739:Ash1l UTSW 3 88,890,152 (GRCm39) missense probably benign 0.19
R4927:Ash1l UTSW 3 88,892,641 (GRCm39) missense probably damaging 1.00
R5000:Ash1l UTSW 3 88,965,941 (GRCm39) missense probably damaging 1.00
R5016:Ash1l UTSW 3 88,889,630 (GRCm39) missense probably damaging 1.00
R5055:Ash1l UTSW 3 88,930,519 (GRCm39) critical splice donor site probably null
R5081:Ash1l UTSW 3 88,892,024 (GRCm39) missense probably damaging 1.00
R5082:Ash1l UTSW 3 88,873,541 (GRCm39) missense probably damaging 0.99
R5090:Ash1l UTSW 3 88,960,184 (GRCm39) missense probably damaging 1.00
R5113:Ash1l UTSW 3 88,973,582 (GRCm39) missense probably damaging 0.99
R5408:Ash1l UTSW 3 88,889,701 (GRCm39) missense probably damaging 1.00
R5452:Ash1l UTSW 3 88,892,183 (GRCm39) missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88,888,733 (GRCm39) missense probably benign 0.17
R5610:Ash1l UTSW 3 88,930,492 (GRCm39) missense probably damaging 1.00
R5624:Ash1l UTSW 3 88,892,916 (GRCm39) missense probably damaging 1.00
R5682:Ash1l UTSW 3 88,914,914 (GRCm39) missense probably damaging 0.99
R5712:Ash1l UTSW 3 88,959,297 (GRCm39) missense probably damaging 0.99
R5719:Ash1l UTSW 3 88,965,933 (GRCm39) missense probably damaging 1.00
R5719:Ash1l UTSW 3 88,961,805 (GRCm39) missense possibly damaging 0.83
R5839:Ash1l UTSW 3 88,890,658 (GRCm39) missense probably damaging 0.99
R5859:Ash1l UTSW 3 88,976,300 (GRCm39) missense probably damaging 1.00
R5877:Ash1l UTSW 3 88,888,891 (GRCm39) missense probably benign 0.00
R5940:Ash1l UTSW 3 88,891,343 (GRCm39) missense probably damaging 0.96
R6026:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6027:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6029:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6033:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6033:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6034:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6034:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6035:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6035:Ash1l UTSW 3 88,892,326 (GRCm39) missense probably damaging 1.00
R6089:Ash1l UTSW 3 88,960,450 (GRCm39) nonsense probably null
R6110:Ash1l UTSW 3 88,892,436 (GRCm39) missense probably damaging 1.00
R6168:Ash1l UTSW 3 88,960,080 (GRCm39) nonsense probably null
R6200:Ash1l UTSW 3 88,977,834 (GRCm39) missense probably damaging 1.00
R6290:Ash1l UTSW 3 88,890,068 (GRCm39) nonsense probably null
R6331:Ash1l UTSW 3 88,915,172 (GRCm39) missense probably benign 0.00
R6425:Ash1l UTSW 3 88,891,087 (GRCm39) missense probably damaging 0.99
R6540:Ash1l UTSW 3 88,892,368 (GRCm39) missense probably damaging 1.00
R6568:Ash1l UTSW 3 88,959,344 (GRCm39) missense probably benign 0.09
R6828:Ash1l UTSW 3 88,983,420 (GRCm39) missense probably benign 0.00
R6843:Ash1l UTSW 3 88,892,695 (GRCm39) missense probably damaging 1.00
R6894:Ash1l UTSW 3 88,890,298 (GRCm39) missense probably benign 0.00
R6976:Ash1l UTSW 3 88,888,964 (GRCm39) missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88,889,978 (GRCm39) missense probably benign 0.00
R7073:Ash1l UTSW 3 88,892,647 (GRCm39) missense probably damaging 1.00
R7133:Ash1l UTSW 3 88,890,764 (GRCm39) frame shift probably null
R7150:Ash1l UTSW 3 88,984,381 (GRCm39) missense probably damaging 1.00
R7205:Ash1l UTSW 3 88,873,259 (GRCm39) missense probably benign 0.00
R7254:Ash1l UTSW 3 88,977,816 (GRCm39) missense probably damaging 1.00
R7272:Ash1l UTSW 3 88,961,941 (GRCm39) splice site probably null
R7288:Ash1l UTSW 3 88,873,199 (GRCm39) start gained probably benign
R7319:Ash1l UTSW 3 88,888,694 (GRCm39) missense probably benign 0.19
R7341:Ash1l UTSW 3 88,889,066 (GRCm39) missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88,873,304 (GRCm39) missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88,891,172 (GRCm39) missense probably benign 0.16
R7677:Ash1l UTSW 3 88,950,500 (GRCm39) missense probably damaging 1.00
R7822:Ash1l UTSW 3 88,914,571 (GRCm39) missense probably benign
R7857:Ash1l UTSW 3 88,891,616 (GRCm39) nonsense probably null
R7889:Ash1l UTSW 3 88,873,345 (GRCm39) missense probably benign 0.00
R7898:Ash1l UTSW 3 88,890,932 (GRCm39) missense possibly damaging 0.54
R7931:Ash1l UTSW 3 88,950,848 (GRCm39) missense probably damaging 1.00
R7937:Ash1l UTSW 3 88,977,624 (GRCm39) nonsense probably null
R7973:Ash1l UTSW 3 88,960,164 (GRCm39) missense probably benign
R8119:Ash1l UTSW 3 88,942,734 (GRCm39) missense probably damaging 1.00
R8157:Ash1l UTSW 3 88,971,014 (GRCm39) critical splice donor site probably null
R8162:Ash1l UTSW 3 88,977,553 (GRCm39) missense probably damaging 0.99
R8194:Ash1l UTSW 3 88,960,062 (GRCm39) missense probably damaging 1.00
R8306:Ash1l UTSW 3 88,873,259 (GRCm39) missense probably benign 0.00
R8497:Ash1l UTSW 3 88,914,951 (GRCm39) missense probably benign 0.02
R8558:Ash1l UTSW 3 88,891,713 (GRCm39) missense probably damaging 0.96
R8744:Ash1l UTSW 3 88,965,890 (GRCm39) missense possibly damaging 0.89
R8923:Ash1l UTSW 3 88,892,974 (GRCm39) missense possibly damaging 0.51
R8969:Ash1l UTSW 3 88,873,598 (GRCm39) missense possibly damaging 0.52
R8970:Ash1l UTSW 3 88,976,307 (GRCm39) missense probably benign 0.00
R9002:Ash1l UTSW 3 88,888,715 (GRCm39) missense probably benign 0.17
R9023:Ash1l UTSW 3 88,892,576 (GRCm39) missense probably damaging 1.00
R9032:Ash1l UTSW 3 88,891,529 (GRCm39) missense probably benign 0.00
R9032:Ash1l UTSW 3 88,889,294 (GRCm39) missense probably benign 0.19
R9049:Ash1l UTSW 3 88,914,671 (GRCm39) missense probably benign
R9085:Ash1l UTSW 3 88,891,529 (GRCm39) missense probably benign 0.00
R9085:Ash1l UTSW 3 88,889,294 (GRCm39) missense probably benign 0.19
R9130:Ash1l UTSW 3 88,965,848 (GRCm39) nonsense probably null
R9149:Ash1l UTSW 3 88,914,530 (GRCm39) missense probably benign
R9294:Ash1l UTSW 3 88,890,297 (GRCm39) missense possibly damaging 0.90
R9365:Ash1l UTSW 3 88,889,207 (GRCm39) missense possibly damaging 0.63
R9450:Ash1l UTSW 3 88,915,139 (GRCm39) missense possibly damaging 0.86
R9542:Ash1l UTSW 3 88,950,566 (GRCm39) missense probably damaging 1.00
R9558:Ash1l UTSW 3 88,889,521 (GRCm39) missense probably benign 0.02
R9572:Ash1l UTSW 3 88,960,188 (GRCm39) missense probably damaging 1.00
R9688:Ash1l UTSW 3 88,892,024 (GRCm39) missense probably damaging 1.00
R9736:Ash1l UTSW 3 88,891,733 (GRCm39) missense probably damaging 1.00
R9765:Ash1l UTSW 3 88,930,500 (GRCm39) missense probably damaging 1.00
R9789:Ash1l UTSW 3 88,873,373 (GRCm39) missense probably benign
X0017:Ash1l UTSW 3 88,891,892 (GRCm39) missense probably benign 0.45
X0019:Ash1l UTSW 3 88,977,863 (GRCm39) missense probably damaging 1.00
X0021:Ash1l UTSW 3 88,890,511 (GRCm39) missense probably benign 0.10
Z1088:Ash1l UTSW 3 88,890,016 (GRCm39) missense probably benign 0.00
Z1176:Ash1l UTSW 3 88,950,524 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCTGGTCATTTATTGCTC -3'
(R):5'- TGAAGGCTCTCGAGAAACCC -3'

Sequencing Primer
(F):5'- ATGCTGGTCATTTATTGCTCAATCC -3'
(R):5'- GCTCTCGAGAAACCCACTGTTC -3'
Posted On 2014-09-18