Incidental Mutation 'R2118:Spag17'
ID231173
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Namesperm associated antigen 17
Synonyms4931427F14Rik, PF6
MMRRC Submission 040122-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R2118 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location99885406-100143322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100049240 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 884 (E884G)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: E884G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: E884G

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.052 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cfhr1 G C 1: 139,550,904 Q243E probably benign Het
Cnih2 C A 19: 5,098,248 A6S possibly damaging Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Gnptab T C 10: 88,436,398 S967P probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1768:Spag17 UTSW 3 100027352 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCCTTGGACAGCTCAGAATC -3'
(R):5'- TGAAGACTCACAGGCATTTGTGG -3'

Sequencing Primer
(F):5'- TGAAGAGTTCGTTCACACCG -3'
(R):5'- TCACAGGCATTTGTGGGCAAC -3'
Posted On2014-09-18