Incidental Mutation 'R0189:Olfr923'
ID23120
Institutional Source Beutler Lab
Gene Symbol Olfr923
Ensembl Gene ENSMUSG00000044798
Gene Nameolfactory receptor 923
SynonymsGA_x6K02T2PVTD-32530445-32531380, MOR164-2
MMRRC Submission 038450-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0189 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location38826545-38830300 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38827815 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 41 (Y41*)
Ref Sequence ENSEMBL: ENSMUSP00000151652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051238] [ENSMUST00000213619] [ENSMUST00000219798]
Predicted Effect probably null
Transcript: ENSMUST00000051238
AA Change: Y35*
SMART Domains Protein: ENSMUSP00000062073
Gene: ENSMUSG00000044798
AA Change: Y35*

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 1.2e-46 PFAM
Pfam:7tm_1 47 296 3.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213550
Predicted Effect probably null
Transcript: ENSMUST00000213619
AA Change: Y35*
Predicted Effect probably null
Transcript: ENSMUST00000219798
AA Change: Y41*
Meta Mutation Damage Score 0.654 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.1%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,096,947 V207A possibly damaging Het
Abca9 A T 11: 110,108,653 W1459R probably damaging Het
Abca9 A T 11: 110,141,662 probably benign Het
Adam25 T A 8: 40,755,430 C578S probably damaging Het
Adam32 T A 8: 24,922,337 probably null Het
Add1 T C 5: 34,616,648 V67A probably benign Het
Aggf1 A T 13: 95,356,480 probably benign Het
Ahcyl2 A T 6: 29,891,243 I449F probably benign Het
Ak6 A G 13: 100,655,142 Y31C probably damaging Het
Akap6 T C 12: 53,141,254 V1817A probably benign Het
Arhgef17 G T 7: 100,928,850 P964T probably damaging Het
Atxn7l3b A T 10: 112,928,580 L48Q possibly damaging Het
Bbs10 T G 10: 111,301,065 S680A probably damaging Het
Bcl7c G A 7: 127,705,764 T164I probably damaging Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Ccdc110 T A 8: 45,935,082 D25E probably damaging Het
Ccdc83 T A 7: 90,226,683 T327S possibly damaging Het
Coro1b T C 19: 4,153,251 Y364H probably damaging Het
Cstf3 A G 2: 104,652,446 D313G probably damaging Het
Dlgap5 T A 14: 47,412,975 probably null Het
Dusp3 A T 11: 101,981,721 I83N probably damaging Het
Eea1 A T 10: 95,995,582 K178N possibly damaging Het
Efr3b T A 12: 3,982,925 D144V probably damaging Het
Gm1110 T A 9: 26,883,218 E504V probably null Het
Got2 T C 8: 95,888,253 H18R probably benign Het
Gprc5b T C 7: 118,983,633 M338V probably benign Het
Has2 A T 15: 56,668,435 F295I probably damaging Het
Hcn3 T C 3: 89,148,800 D519G probably damaging Het
Ino80 T A 2: 119,379,679 D1377V probably benign Het
Iqsec3 A T 6: 121,413,562 probably benign Het
Kif3c T A 12: 3,365,989 S3R probably benign Het
Krt17 A G 11: 100,260,619 I116T possibly damaging Het
Lrba T C 3: 86,368,509 V1728A probably damaging Het
Map3k6 G T 4: 133,246,941 V550L possibly damaging Het
Mcph1 T C 8: 18,788,471 V803A probably damaging Het
Med13 A G 11: 86,319,876 V480A probably benign Het
Msh5 T C 17: 35,029,654 E772G probably null Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ndfip2 T C 14: 105,304,740 L308P probably damaging Het
Ndufb10 T C 17: 24,724,235 T34A probably benign Het
Nipal3 A T 4: 135,468,518 I258N possibly damaging Het
Nup54 A G 5: 92,422,564 V328A probably damaging Het
Olfr1410 T C 1: 92,607,893 F19L probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr615 G T 7: 103,561,082 V202F probably benign Het
Olfr763 T A 10: 129,011,322 F12L possibly damaging Het
Oprm1 T C 10: 6,789,071 V66A possibly damaging Het
Peg12 G A 7: 62,463,548 T267I unknown Het
Phf20 A G 2: 156,303,141 S890G probably benign Het
Plk2 C T 13: 110,399,463 T567M probably damaging Het
Pola2 A T 19: 5,942,342 probably benign Het
Ppp1r12b A G 1: 134,865,776 probably null Het
Prickle1 A T 15: 93,503,019 L528* probably null Het
Prpf6 T A 2: 181,655,457 N903K probably benign Het
Ptprc G A 1: 138,082,715 A601V probably benign Het
Ranbp1 A T 16: 18,241,743 probably null Het
Rapgef6 C T 11: 54,691,249 S1334L probably benign Het
Rgs2 T C 1: 144,002,284 probably null Het
Ripk2 A T 4: 16,129,125 probably null Het
Rnf17 A G 14: 56,482,193 S967G probably null Het
Rock2 T A 12: 16,959,516 probably benign Het
Rpusd3 C T 6: 113,415,553 probably null Het
Scgb1b20 G T 7: 33,373,510 V48L probably benign Het
Sec16a T A 2: 26,424,414 probably null Het
Serpina5 T A 12: 104,103,330 L267H probably damaging Het
Slc12a3 C T 8: 94,356,358 H875Y probably benign Het
Slc45a4 A G 15: 73,581,914 S745P probably benign Het
Sucla2 T C 14: 73,592,648 V375A probably damaging Het
Sun2 C A 15: 79,737,076 V213F probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 C T 6: 7,562,424 R129C probably damaging Het
Taf6 T C 5: 138,182,713 E202G probably benign Het
Tex21 T A 12: 76,239,533 H64L probably benign Het
Tgs1 A G 4: 3,593,620 S503G probably benign Het
Tmem184c C T 8: 77,597,812 V350I possibly damaging Het
Tnks1bp1 A G 2: 85,070,929 S960G possibly damaging Het
Trbc2 T C 6: 41,548,149 probably benign Het
Tsta3 C A 15: 75,926,978 D127Y probably damaging Het
Tubgcp2 A T 7: 140,001,605 probably benign Het
Vmn1r39 T A 6: 66,805,197 T46S probably benign Het
Vmn1r61 T C 7: 5,610,700 H205R probably benign Het
Zdhhc14 T C 17: 5,725,264 S264P possibly damaging Het
Zfp101 T A 17: 33,382,239 H181L possibly damaging Het
Other mutations in Olfr923
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Olfr923 APN 9 38828599 missense possibly damaging 0.93
IGL01521:Olfr923 APN 9 38827889 missense probably damaging 1.00
IGL01548:Olfr923 APN 9 38828350 missense probably benign 0.00
IGL02240:Olfr923 APN 9 38828306 missense probably benign 0.12
IGL02794:Olfr923 APN 9 38828215 missense probably damaging 1.00
R0116:Olfr923 UTSW 9 38828564 missense probably damaging 0.99
R0118:Olfr923 UTSW 9 38827858 missense possibly damaging 0.62
R1381:Olfr923 UTSW 9 38828338 missense probably benign 0.04
R1512:Olfr923 UTSW 9 38828364 nonsense probably null
R1702:Olfr923 UTSW 9 38828543 missense probably damaging 1.00
R2357:Olfr923 UTSW 9 38828338 missense probably benign 0.00
R2863:Olfr923 UTSW 9 38828539 missense possibly damaging 0.89
R2985:Olfr923 UTSW 9 38828110 missense probably benign 0.05
R5475:Olfr923 UTSW 9 38828466 missense possibly damaging 0.81
R5682:Olfr923 UTSW 9 38828128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGAATTGTACCTGCAAAGCCAC -3'
(R):5'- AGAAGGTCAGTCTTGCCATGCAAAG -3'

Sequencing Primer
(F):5'- CTTTTAGGGAACAACAGAGTTCAG -3'
(R):5'- CATAACGGTCATATGCCATTGC -3'
Posted On2013-04-16