Incidental Mutation 'R2118:Gnptab'
ID231215
Institutional Source Beutler Lab
Gene Symbol Gnptab
Ensembl Gene ENSMUSG00000035311
Gene NameN-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
SynonymsEG432486
MMRRC Submission 040122-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.928) question?
Stock #R2118 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location88379132-88447329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88436398 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 967 (S967P)
Ref Sequence ENSEMBL: ENSMUSP00000020251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020251] [ENSMUST00000151273]
Predicted Effect probably benign
Transcript: ENSMUST00000020251
AA Change: S967P

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020251
Gene: ENSMUSG00000035311
AA Change: S967P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Stealth_CR1 73 101 6.6e-14 PFAM
Pfam:Stealth_CR2 322 429 8.8e-49 PFAM
NL 431 469 3.82e-7 SMART
low complexity region 480 490 N/A INTRINSIC
NL 498 536 2.37e-2 SMART
DMAP_binding 699 813 6.14e-38 SMART
Pfam:Stealth_CR3 934 982 2.9e-21 PFAM
Pfam:Stealth_CR4 1117 1173 7.9e-28 PFAM
transmembrane domain 1192 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141343
Predicted Effect probably benign
Transcript: ENSMUST00000151273
SMART Domains Protein: ENSMUSP00000118025
Gene: ENSMUSG00000035311

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155306
Meta Mutation Damage Score 0.216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two of three subunit types of the membrane-bound enzyme N-acetylglucosamine-1-phosphotransferase, a heterohexameric complex composed of two alpha, two beta, and two gamma subunits. The encoded protein is proteolytically cleaved at the Lys928-Asp929 bond to yield mature alpha and beta polypeptides while the gamma subunits are the product of a distinct gene (GeneID 84572). In the Golgi apparatus, the heterohexameric complex catalyzes the first step in the synthesis of mannose 6-phosphate recognition markers on certain oligosaccharides of newly synthesized lysosomal enzymes. These recognition markers are essential for appropriate trafficking of lysosomal enzymes. Mutations in this gene have been associated with both mucolipidosis II and mucolipidosis IIIA.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutations cause stunted growth, high lysosomal enzyme levels, skeletal defects, retinal degeneration and secretory cell lesions. Homozygotes for an ENU allele show skeletal and facial defects, altered enzymatic activities, lysosomal storage, Purkinje cell loss, ataxia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cfhr1 G C 1: 139,550,904 Q243E probably benign Het
Cnih2 C A 19: 5,098,248 A6S possibly damaging Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Spag17 A G 3: 100,049,240 E884G possibly damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Gnptab
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01326:Gnptab APN 10 88433065 missense probably damaging 0.99
IGL01346:Gnptab APN 10 88436179 missense possibly damaging 0.65
IGL01626:Gnptab APN 10 88437495 missense probably damaging 0.98
IGL01642:Gnptab APN 10 88436132 missense possibly damaging 0.89
IGL02121:Gnptab APN 10 88429461 missense possibly damaging 0.90
IGL03076:Gnptab APN 10 88440289 missense possibly damaging 0.91
IGL03130:Gnptab APN 10 88436371 missense possibly damaging 0.95
maze UTSW 10 88432573 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0103:Gnptab UTSW 10 88429519 missense probably damaging 1.00
R0114:Gnptab UTSW 10 88433400 missense possibly damaging 0.48
R0206:Gnptab UTSW 10 88439510 missense probably damaging 0.98
R0288:Gnptab UTSW 10 88433105 missense probably benign 0.00
R0329:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0330:Gnptab UTSW 10 88440309 missense probably damaging 1.00
R0369:Gnptab UTSW 10 88433594 missense possibly damaging 0.87
R0385:Gnptab UTSW 10 88436525 missense probably damaging 1.00
R0522:Gnptab UTSW 10 88431466 splice site probably benign
R0569:Gnptab UTSW 10 88428557 missense possibly damaging 0.89
R0671:Gnptab UTSW 10 88443304 splice site probably benign
R0834:Gnptab UTSW 10 88429952 missense probably damaging 1.00
R1375:Gnptab UTSW 10 88432573 missense probably damaging 1.00
R1443:Gnptab UTSW 10 88434081 missense probably damaging 1.00
R1464:Gnptab UTSW 10 88445754 splice site probably benign
R1471:Gnptab UTSW 10 88445763 missense probably benign
R1570:Gnptab UTSW 10 88419454 missense probably damaging 0.99
R1612:Gnptab UTSW 10 88428482 splice site probably null
R1614:Gnptab UTSW 10 88414589 missense probably benign
R1638:Gnptab UTSW 10 88436167 missense possibly damaging 0.94
R1739:Gnptab UTSW 10 88436095 missense probably benign 0.14
R1894:Gnptab UTSW 10 88419127 missense possibly damaging 0.69
R2092:Gnptab UTSW 10 88440305 nonsense probably null
R2144:Gnptab UTSW 10 88428506 missense possibly damaging 0.89
R2174:Gnptab UTSW 10 88434044 missense probably damaging 1.00
R3847:Gnptab UTSW 10 88433577 nonsense probably null
R3943:Gnptab UTSW 10 88433894 missense probably benign
R4434:Gnptab UTSW 10 88412622 missense probably damaging 1.00
R4545:Gnptab UTSW 10 88414595 missense probably benign 0.00
R4776:Gnptab UTSW 10 88436528 missense probably damaging 1.00
R4786:Gnptab UTSW 10 88436182 missense probably damaging 1.00
R4880:Gnptab UTSW 10 88432551 nonsense probably null
R4889:Gnptab UTSW 10 88433913 missense probably benign 0.00
R4923:Gnptab UTSW 10 88429623 missense probably benign 0.17
R5694:Gnptab UTSW 10 88414486 missense probably benign 0.01
R5943:Gnptab UTSW 10 88433514 missense probably benign 0.00
R6027:Gnptab UTSW 10 88433225 missense probably damaging 0.98
R6074:Gnptab UTSW 10 88433078 missense probably damaging 1.00
R6119:Gnptab UTSW 10 88431395 missense probably damaging 1.00
R6182:Gnptab UTSW 10 88429480 missense possibly damaging 0.71
R6757:Gnptab UTSW 10 88437502 missense probably damaging 0.98
R6910:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R6911:Gnptab UTSW 10 88431396 missense probably damaging 1.00
R7094:Gnptab UTSW 10 88379504 missense possibly damaging 0.66
R7101:Gnptab UTSW 10 88440312 missense probably benign 0.19
R7164:Gnptab UTSW 10 88434070 nonsense probably null
R7214:Gnptab UTSW 10 88379157 unclassified probably benign
R7316:Gnptab UTSW 10 88400710 missense probably damaging 1.00
X0064:Gnptab UTSW 10 88436530 missense probably damaging 1.00
X0066:Gnptab UTSW 10 88412011 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGATCGTTATGCAAGAACTCC -3'
(R):5'- CCTGCAAGCTTAAAGGTAGGTC -3'

Sequencing Primer
(F):5'- CAAGATATGTAAGTCTTCGTTGTGCC -3'
(R):5'- CAAGCTTAAAGGTAGGTCGTGAATTC -3'
Posted On2014-09-18